4-1BBL (4-1BB ligand), also known as CD137L or TNFSF9, is single pass type II transmembrane protein that belongs to the TNF superfamily (TNFSF).  4-1BBL is a  a bidirectional signal transducer that acts as a high affinity ligand for 4-1BB/CD137/TNFRSF9, a member of the TNF-receptor superfamily (TNFRSF).  Members of the TNFRSF have been shown to play critical roles in regulating cellular activation, differentiation and apoptosis.  The extracellular domain (ECD) of 4-1BBL has a jellyroll, β-sandwich tertiary structure that is similar to other TNFSF members. 4-1BBL is expressed by activated B cells, macrophages, dendritic cells, activated T cells, neurons and astrocytes.  A soluble active form of 4-1BBL is detected in humans, presumably generated by MMP activity. 4-1BBL may signal through both 4-1BB and itself as its cytoplasmic tail participates in reverse signaling to induce apoptosis in T cells and secretion of cytokines such as IL6 and TNFα by monocytes. 4-1BBL/4-1BB signaling is involved in the antigen presentation process and in the generation of cytotoxic T cells.  4-1BBL/4-1BB interaction also provides a co-stimulatory signal to T cells, and increases T cell proliferation and cytokines production. 4-1BBL may play a key role in T cell recall response and maintaining T cell numbers. 4-1BBL is required for the optimal CD8 responses in CD8 T cells. 4-1BBL is expressed on cancer cells, and is thought to be involved in T cell-tumor cell interaction.  4-1BBL may also play a role in interactions between T-cells and B-cells/macrophages.  4-1BBL is implicated in cancers, infectious diseases and autoimmune diseases.

4-1BBL (4-1BB ligand), also known as CD137L or TNFSF9, is single pass type II transmembrane protein that belongs to the TNF superfamily (TNFSF).  4-1BBL is a  a bidirectional signal transducer that acts as a high affinity ligand for 4-1BB/CD137/TNFRSF9, a member of the TNF-receptor superfamily (TNFRSF).  Members of the TNFRSF have been shown to play critical roles in regulating cellular activation, differentiation and apoptosis.  The extracellular domain (ECD) of 4-1BBL has a jellyroll, β-sandwich tertiary structure that is similar to other TNFSF members. 4-1BBL is expressed by activated B cells, macrophages, dendritic cells, activated T cells, neurons and astrocytes.  A soluble active form of 4-1BBL is detected in humans, presumably generated by MMP activity. 4-1BBL may signal through both 4-1BB and itself as its cytoplasmic tail participates in reverse signaling to induce apoptosis in T cells and secretion of cytokines such as IL6 and TNFα by monocytes. 4-1BBL/4-1BB signaling is involved in the antigen presentation process and in the generation of cytotoxic T cells.  4-1BBL/4-1BB interaction also provides a co-stimulatory signal to T cells, and increases T cell proliferation and cytokines production. 4-1BBL may play a key role in T cell recall response and maintaining T cell numbers. 4-1BBL is required for the optimal CD8 responses in CD8 T cells. 4-1BBL is expressed on cancer cells, and is thought to be involved in T cell-tumor cell interaction.  4-1BBL may also play a role in interactions between T-cells and B-cells/macrophages.  4-1BBL is implicated in cancers, infectious diseases and autoimmune diseases.

  

Product Details

 

Gene Symbol: 4-1BBL; TNFSF9; CD137L; TNLG5A; 4-1BB-L

  

NCBI Gene ID: 8744

 

Uniprot Entry: P41273

 

Construct Details: Full length human 4-1BBL gene is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter with or without a selection marker, which can be used for both transient and stable expression in mammalian cells.  It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles.

 

Vector Type: pLTC (lentiviral expression vector containing a heterologous CMV promoter and a marker, see the vector map above)

 

Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)

 

Gene Insert Sequence:  

ATGGAATACGCCTCTGACGCTTCACTGGACCCCGAAGCCCCGTGGCCTCCCGCGCCCCGCGCTCGCGCCT

GCCGCGTACTGCCTTGGGCCCTGGTCGCGGGGCTGCTGCTGCTGCTGCTGCTCGCTGCCGCCTGCGCCGT

CTTCCTCGCCTGCCCCTGGGCCGTGTCCGGGGCTCGCGCCTCGCCCGGCTCCGCGGCCAGCCCGAGACTC

CGCGAGGGTCCCGAGCTTTCGCCCGACGATCCCGCCGGCCTCTTGGACCTGCGGCAGGGCATGTTTGCGC

AGCTGGTGGCCCAAAATGTTCTGCTGATCGATGGGCCCCTGAGCTGGTACAGTGACCCAGGCCTGGCAGG

CGTGTCCCTGACGGGGGGCCTGAGCTACAAAGAGGACACGAAGGAGCTGGTGGTGGCCAAGGCTGGAGTC

TACTATGTCTTCTTTCAACTAGAGCTGCGGCGCGTGGTGGCCGGCGAGGGCTCAGGCTCCGTTTCACTTG

CGCTGCACCTGCAGCCACTGCGCTCTGCTGCTGGGGCCGCCGCCCTGGCTTTGACCGTGGACCTGCCACC

CGCCTCCTCCGAGGCTCGGAACTCGGCCTTCGGTTTCCAGGGCCGCTTGCTGCACCTGAGTGCCGGCCAG

CGCCTGGGCGTCCATCTTCACACTGAGGCCAGGGCACGCCATGCCTGGCAGCTTACCCAGGGCGCCACAG

TCTTGGGACTCTTCCGGGTGACCCCCGAAATCCCAGCCGGACTCCCTTCACCGAGGTCGGAATAA

 

Primers: Gene insert coding sequence can be confirmed by following primers:

(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;

(b) reverse (or 3'-end) primer: 5’-CGGGAAGCAATAGCATGATA-3’

 

 

Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification.  High fidelity PCR systems should always be used. 

 

  

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Storage

 

The product is shipped at 4°C. Upon receipt, centrifuge the product briefly before opening the vial. It is recommended to store small aliquots at the temperature below –20°C for long-term storage and the product is stable for 6 months. 

 

 

 

 

Use a manual defrost freezer and avoid repeated freeze-thaw cycles.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

 

References

 

 

1. Eur. J. Immunol. 24:2219 (1994)

2. J. Immunol. 160:2488 (1998)

3. J. Immunol. 167:4059 (2001)

4. Immunol Rev. 229: 192 (2009)

5. J. Biol. Chem. 285:9202 (2010) 

 

 

 

Documentation

 

Product datasheet (pdf) can be downloaded here: LTP2590-PDS.pdf

 

 

 

Additional supporting documents, including COA and MSDS are available upon request.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.