Smaller Font Default Font Larger Font

You are here:

PrintEmail

Human CD27 Full-length Gene in Lentivector, Endotoxin-free DNA

Product ID: pLTC-CD27 (SKU#: LTP0102)

For Bulk Order: Call for price

Price:
$796.00
Size

Selection Marker

Description

 

CD27 is a single-pass, type I transmembrane glycoprotein in the TNF receptor superfamily (TNFRSF7).  CD27 is expressed as a disulfide­linked homodimer on the cell surface. Proteolytic cleavage of CD27 results in the shedding of a 28­32 kDa fragment of the extracellular domain (ECD) with three TNFR cysteine­rich repeats.  The expression of CD27 is limited to cells of the lymphoid lineage.  CD27 is weakly expressed on naïve T cells and NK cells and is up­regulated upon cell activation. It is also up­regulated on activated germinal center B cells, plasma cells, and a subset of memory B cells.  CD27 acts as a co­stimulatory molecule that supports lymphocyte activation and survival. As a T and B cell co-stimulatory molecule, the activity of CD27 is governed by a TNF-like ligand CD70 on lymphocytes and dendritic cells. CD27 binds to the transmembrane glycoprotein CD70 that is expressed on activated B cells, activated T cells, and dendritic cells.  CD27 transduces signals and subsequently leads to the activation of NF-κB and JNK pathways that contribute to the activation and survival of T cells and NK cells as well as the long-term maintenance of T cell immunity. CD27 also plays a key role in regulating B-cell differentiation, activation and immunoglobulin synthesis. Ligation of CD27 on B cells promotes germinal center formation and the expansion and affinity maturation of memory B cell responses. Mutations in the CD27 gene are associated with an autosomal recessive immunodeficiency disorder, lymphoproliferative syndrome 2 (LPFS2).

 

 

 

CD27 is a single-pass, type I transmembrane glycoprotein in the TNF receptor superfamily (TNFRSF7).  CD27 is expressed as a disulfide­linked homodimer on the cell surface. Proteolytic cleavage of CD27 results in the shedding of a 28­32 kDa fragment of the extracellular domain (ECD) with three TNFR cysteine­rich repeats.  The expression of CD27 is limited to cells of the lymphoid lineage.  CD27 is weakly expressed on naïve T cells and NK cells and is up­regulated upon cell activation. It is also up­regulated on activated germinal center B cells, plasma cells, and a subset of memory B cells.  CD27 acts as a co­stimulatory molecule that supports lymphocyte activation and survival. As a T and B cell co-stimulatory molecule, the activity of CD27 is governed by a TNF-like ligand CD70 on lymphocytes and dendritic cells. CD27 binds to the transmembrane glycoprotein CD70 that is expressed on activated B cells, activated T cells, and dendritic cells.  CD27 transduces signals and subsequently leads to the activation of NF-κB and JNK pathways that contribute to the activation and survival of T cells and NK cells as well as the long-term maintenance of T cell immunity. CD27 also plays a key role in regulating B-cell differentiation, activation and immunoglobulin synthesis. Ligation of CD27 on B cells promotes germinal center formation and the expansion and affinity maturation of memory B cell responses. Mutations in the CD27 gene are associated with an autosomal recessive immunodeficiency disorder, lymphoproliferative syndrome 2 (LPFS2).

 

 

Product Details

 

Gene Symbol: TNFRSF7; T14; S152; Tp55; S152. LPFS2

  

NCBI Gene ID: 939

 

Uniprot Entry: P26842

 

Construct Details: Full length human CD27 gene is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter, which can be used for both transient and stable expression in mammalian cells.  It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles.

 

Vector Type: pLTC (lentiviral expression vector containing a heterologous CMV promoter, see the vector map above)

 

Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)

 

Gene Insert Sequence:  

ATGGCACGGCCACATCCCTGGTGGCTGTGCGTTCTGGGGACCCTGGTGGGGCTCTCAGCTACTCCAGCCCCCAAGAGCTG

CCCAGAGAGGCACTACTGGGCTCAGGGAAAGCTGTGCTGCCAGATGTGTGAGCCAGGAACATTCCTCGTGAAGGACTGTG

ACCAGCATAGAAAGGCTGCTCAGTGTGATCCTTGCATACCGGGGGTCTCCTTCTCTCCTGACCACCACACCCGGCCCCAC

TGTGAGAGCTGTCGGCACTGTAACTCTGGTCTTCTCGTTCGCAACTGCACCATCACTGCCAATGCTGAGTGTGCCTGTCG

CAATGGCTGGCAGTGCAGGGACAAGGAGTGCACCGAGTGTGATCCTCTTCCAAACCCTTCGCTGACCGCTCGGTCGTCTC

AGGCCCTGAGCCCACACCCTCAGCCCACCCACTTACCTTATGTCAGTGAGATGCTGGAGGCCAGGACAGCTGGGCACATG

CAGACTCTGGCTGACTTCAGGCAGCTGCCTGCCCGGACTCTCTCTACCCACTGGCCACCCCAAAGATCCCTGTGCAGCTC

CGATTTTATTCGCATCCTTGTGATCTTCTCTGGAATGTTCCTTGTTTTCACCCTGGCCGGGGCCCTGTTCCTCCATCAAC

GAAGGAAATATAGATCAAACAAAGGAGAAAGTCCTGTGGAGCCTGCAGAGCCTTGTCATTACAGCTGCCCCAGGGAGGAG

GAGGGCAGCACCATCCCCATCCAGGAGGATTACCGAAAACCGGAGCCTGCCTGCTCCCCCTGA

 

Primers: Gene insert coding sequence can be confirmed by following primers:

(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;

(b) reverse (or 3'-end) primer: 5’-CGGGAAGCAATAGCATGATA-3’

 

 

Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification.  High fidelity PCR systems should always be used. 

 

  

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Storage

 

The product is shipped at 4°C. Upon receipt, centrifuge the product briefly before opening the vial. It is recommended to store small aliquots at the temperature below –20°C for long-term storage and the product is stable for 6 months. 

 

 

 

 

Use a manual defrost freezer and avoid repeated freeze-thaw cycles.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

 

References

 

 

1. J. Immunol. 139:1589 (1987). 

2. Cell 73:447 (1993).

3. J. Immunol. 152:1756 (1994).

4. Proc. Natl. Acad. Sci. 92: 11249 (1995). 

5. Immunol. Rev. 229:216 (2009).

 

 

 



 

Documentation

 

Product datasheet (pdf) can be downloaded here: LTP0102-PDS.pdf

 

 

 

Additional supporting documents, including COA and MSDS are available upon request.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Molecule Class 1-Pass Type I Transmembrane
Gene Synonym CD27; TNFRSF7; T14; S152; Tp55; S152. LPFS2
Gene Family TNF Receptor (TNFR) Superfamily
Research Area Immunology
"A" - "Z" List
C
Pathway/Disease T Cell Costimulation
Species
Human
CD Antigen CD27

Search Products

Categories
Molecule Class
Gene Family
Pathway/Disease
Research Area
CD Antigen
"A" - "Z" List
Reset All

Special Offers & Rewards

Promotion

Earn discounts, credits or rewards with your purchases.

Purchase or Clone My Genes

My Gene Clones

Get the sequence-verified, expression-ready gene clones.

Recombinant Proteins

Recombinant Proteins

Oder your high-quality, recombinant proteins of interest.

Recombinant Antibodies

Recombinant Antibodies

Try our products & services for your antibody R&D.

Virus-Based Gene Expression

Virus Gene Delivery

Acquire high titer, ready-to-use viral particles.

Get in Touch with Us

Send your question or feedback on our products & services