4­-1BB, also known as CD137, ILA and TNFRSF9, is a single-pass type I transmembrane glycoprotein of the TNF receptor superfamily (TNFRSF). 4­1BB is expressed as a disulfide­linked homodimer on activated T cells.  4-1BB is absent from naive T cells, but its expression is induced by lymphocyte activation. 4-1BB is the receptor for 4-1BB ligand/TNFSF9, which is expressed on antigen-presenting cells such as macrophages and activated B cells. 4-1BB mediated signaling pathway contributes to the proliferation, survival, and development of T cells. 4-1BB can also promote proliferation in peripheral monocytes, enhance T cell apoptosis triggered by TCR-CD3 activation, and regulate CD28 co-stimulation to promote Th1 cell responses.  4­1BB deficient mice show augmented T cell activation.  4-1BB and its ligand are also expressed in different human tumor tissues. 4­-1BB activation by crosslinking with its ligand or agonistic antibody enhances cytotoxic T cell and NK cell mediated anti­tumor immunity. 4­-1BB can interact with OX40 on activated T cells, forming a complex that responds to either ligand and inhibits Treg and CD8+ T cell proliferation.  4-1BB may also be involved in the development of inflammation in high fat diet­induced metabolic syndrome. The soluble form of 4­-1BB circulates at elevated levels in the serum of rheumatoid arthritis. 

4­-1BB, also known as CD137, ILA and TNFRSF9, is a single-pass type I transmembrane glycoprotein of the TNF receptor superfamily (TNFRSF). 4­1BB is expressed as a disulfide­linked homodimer on activated T cells.  4-1BB is absent from naive T cells, but its expression is induced by lymphocyte activation. 4-1BB is the receptor for 4-1BB ligand/TNFSF9, which is expressed on antigen-presenting cells such as macrophages and activated B cells. 4-1BB mediated signaling pathway contributes to the proliferation, survival, and development of T cells. 4-1BB can also promote proliferation in peripheral monocytes, enhance T cell apoptosis triggered by TCR-CD3 activation, and regulate CD28 co-stimulation to promote Th1 cell responses.  4­1BB deficient mice show augmented T cell activation.  4-1BB and its ligand are also expressed in different human tumor tissues. 4­-1BB activation by crosslinking with its ligand or agonistic antibody enhances cytotoxic T cell and NK cell mediated anti­tumor immunity. 4­-1BB can interact with OX40 on activated T cells, forming a complex that responds to either ligand and inhibits Treg and CD8+ T cell proliferation.  4-1BB may also be involved in the development of inflammation in high fat diet­induced metabolic syndrome. The soluble form of 4­-1BB circulates at elevated levels in the serum of rheumatoid arthritis. 

  

Product Details

 

Gene Symbol: 4-1BB;CD137; ILA; TNFRSF9; CDw137; MGC2172

 

NCBI Gene ID: 3604

 

Uniprot Entry: Q07011

 

Construct Details: Full length human 4-1BB/CD137 gene is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter, which can be used for both transient and stable expression in mammalian cells.  It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles.

 

Vector Type: pLTC (lentiviral expression vector containing a heterologous CMV promoter, see the vector map above)

 

Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)

 

Gene Insert Size: 768 (bp)

 

Gene Insert Sequence:  

ATGGGAAACAGCTGTTACAACATAGTAGCCACTCTGTTGCTGGTCCTCAACTTTGAGAGGACAAGATCATTGCAGGATCC

TTGTAGTAACTGCCCAGCTGGTACATTCTGTGATAATAACAGGAATCAGATTTGCAGTCCCTGTCCTCCAAATAGTTTCT

CCAGCGCAGGTGGACAAAGGACCTGTGACATATGCAGGCAGTGTAAAGGTGTTTTCAGGACCAGGAAGGAGTGTTCCTCC

ACCAGCAATGCAGAGTGTGACTGCACTCCAGGGTTTCACTGCCTGGGGGCAGGATGCAGCATGTGTGAACAGGATTGTAA

ACAAGGTCAAGAACTGACAAAAAAAGGTTGTAAAGACTGTTGCTTTGGGACATTTAACGATCAGAAACGTGGCATCTGTC

GACCCTGGACAAACTGTTCTTTGGATGGAAAGTCTGTGCTTGTGAATGGGACGAAGGAGAGGGACGTGGTCTGTGGACCA

TCTCCAGCCGACCTCTCTCCGGGAGCATCCTCTGTGACCCCGCCTGCCCCTGCGAGAGAGCCAGGACACTCTCCGCAGAT

CATCTCCTTCTTTCTTGCGCTGACGTCGACTGCGTTGCTCTTCCTGCTGTTCTTCCTCACGCTCCGTTTCTCTGTTGTTA

AACGGGGCAGAAAGAAACTCCTGTATATATTCAAACAACCATTTATGAGACCAGTACAAACTACTCAAGAGGAAGATGGC

TGTAGCTGCCGATTTCCAGAAGAAGAAGAAGGAGGATGTGAACTGTGA

  

Primers: Gene insert coding sequence can be confirmed by following primers:

(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;

(b) reverse (or 3'-end) primer: 5’-CGGGAAGCAATAGCATGATA-3’

 

 

Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification.  High fidelity PCR systems should always be used. 

 

  

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Storage

 

The product is shipped at 4°C. Upon receipt, centrifuge the product briefly before opening the vial. It is recommended to store small aliquots at the temperature below –20°C for long-term storage and the product is stable for 6 months. 

 

 

Use a manual defrost freezer and avoid repeated freeze-thaw cycles.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

 

References

 

1. J. Immunol. 168:4897 (2002).

2. Nat. Immunol. 9:917 (2008).

3. Trends Pharmacol. Sci. 29(8): 383 (2008).

4. Immunol. Rev. 229:192 (2009).

5. Diabetes 60:3159 (2011).

 

 

Documentation

 

Product datasheet (pdf) can be downloaded here: LTP0100-PDS.pdf

 

 

 

Additional supporting documents, including COA and MSDS are available upon request.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.