GITR (Glucocorticoid-induced TNFR-related protein), also known as CD357 and AITR (Activation-inducible TNFR family receptor), is a single-pass type I transmembrane glycoprotein in the TNF receptor superfamily (TNFRSF18). GITR contains 3 TNFR cysteine-rich repeats in the extracellular region and a cytoplasmic domain that shows striking homology with those of TNFRSF members 4­1BB/CD137 and CD27.  GITR is expressed at low levels in peripheral blood T cells, bone marrow, thymus, spleen, and lymph nodes. GITR is up­ regulated in peripherical mononuclear cells after antigen stimulation/lymphocyte activation by treatment with anti­CD3 plus anti­CD28, or PMA plus ionomycin.  Knockout studies indicate that GITR may play a key role in dominant immunological self-tolerance maintained by CD25(+)CD4(+) regulatory T cells and in the regulation of CD3-driven T-cell activation and programmed cell death. GITR is the receptor for GITR ligand (GITRL) belonging to the TNF superfamily (TNFSF18). GITR and its ligand GITRL are involved in interactions between activated T-lymphocytes and endothelial cells and in the regulation of T-cell receptor-mediated cell death. Ligation of GITRL can activate NF­κB through several TRAF adaptor proteins, and protect T cells from TCR activation­induced cell death. GITR and GITRL have also been shown to be important co-stimulatory molecules in the pathogenesis of autoimmune diseases.

GITR (Glucocorticoid-induced TNFR-related protein), also known as CD357 and AITR (Activation-inducible TNFR family receptor), is a single-pass type I transmembrane glycoprotein in the TNF receptor superfamily (TNFRSF18). GITR contains 3 TNFR cysteine-rich repeats in the extracellular region and a cytoplasmic domain that shows striking homology with those of TNFRSF members 4­1BB/CD137 and CD27.  GITR is expressed at low levels in peripheral blood T cells, bone marrow, thymus, spleen, and lymph nodes. GITR is up­ regulated in peripherical mononuclear cells after antigen stimulation/lymphocyte activation by treatment with anti­CD3 plus anti­CD28, or PMA plus ionomycin.  Knockout studies indicate that GITR may play a key role in dominant immunological self-tolerance maintained by CD25(+)CD4(+) regulatory T cells and in the regulation of CD3-driven T-cell activation and programmed cell death. GITR is the receptor for GITR ligand (GITRL) belonging to the TNF superfamily (TNFSF18). GITR and its ligand GITRL are involved in interactions between activated T-lymphocytes and endothelial cells and in the regulation of T-cell receptor-mediated cell death. Ligation of GITRL can activate NF­κB through several TRAF adaptor proteins, and protect T cells from TCR activation­induced cell death. GITR and GITRL have also been shown to be important co-stimulatory molecules in the pathogenesis of autoimmune diseases.

  

Product Details

 

Gene Symbol: TNFRSF18; AITR; CD357; GITR-D; UNQ319/PRO364

  

NCBI Gene ID: 8784

 

Uniprot Entry: Q9Y5U5

 

Construct Details: Full length human GITR gene is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter, which can be used for both transient and stable expression in mammalian cells.  It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles.

 

Vector Type: pLTC (lentiviral expression vector containing a heterologous CMV promoter, see the vector map above)

 

Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)

 

Gene Insert Sequence:  

ATGGCACAGCACGGGGCGATGGGCGCGTTTCGGGCCCTGTGCGGCCTGGCGCTGCTGTGCGCGCTCAGCCTGGGTCAGCG

CCCCACCGGGGGTCCCGGGTGCGGCCCTGGGCGCCTCCTGCTTGGGACGGGAACGGACGCGCGCTGCTGCCGGGTTCACA

CGACGCGCTGCTGCCGCGATTACCCGGGCGAGGAGTGCTGTTCCGAGTGGGACTGCATGTGTGTCCAGCCTGAATTCCAC

TGCGGAGACCCTTGCTGCACGACCTGCCGGCACCACCCTTGTCCCCCAGGCCAGGGGGTACAGTCCCAGGGGAAATTCAG

TTTTGGCTTCCAGTGTATCGACTGTGCCTCGGGGACCTTCTCCGGGGGCCACGAAGGCCACTGCAAACCTTGGACAGACT

GCACCCAGTTCGGGTTTCTCACTGTGTTCCCTGGGAACAAGACCCACAACGCTGTGTGCGTCCCAGGGTCCCCGCCGGCA

GAGCCGCTTGGGTGGCTGACCGTCGTCCTCCTGGCCGTGGCCGCCTGCGTCCTCCTCCTGACCTCGGCCCAGCTTGGACT

GCACATCTGGCAGCTGAGGAGTCAGTGCATGTGGCCCCGAGAGACCCAGCTGCTGCTGGAGGTGCCGCCGTCGACCGAAG

ACGCCAGAAGCTGCCAGTTCCCCGAGGAAGAGCGGGGCGAGCGATCGGCAGAGGAGAAGGGGCGGCTGGGAGACCTGTGG

GTGTGA

 

Primers: Gene insert coding sequence can be confirmed by following primers:

(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;

(b) reverse (or 3'-end) primer: 5’-CGGGAAGCAATAGCATGATA-3’

 

 

Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification.  High fidelity PCR systems should always be used. 

 

  

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Storage

 

The product is shipped at 4°C. Upon receipt, centrifuge the product briefly before opening the vial. It is recommended to store small aliquots at the temperature below –20°C for long-term storage and the product is stable for 6 months. 

 

 

Use a manual defrost freezer and avoid repeated freeze-thaw cycles.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

 

References

 

 

1. Proc. Natl. Acad. Sci. USA 94:6216 (1997). 

2. J. Biol. Chem. 274:6056 (1999). 

3. Current Biology 9:215 (1999). 

4. Cell Death Differ. 7:408 (2000). 

5. Oncol Rep. 18: 1189 (2007).

 

 

 

 

 

Documentation

 

Product datasheet (pdf) can be downloaded here: LTP0289-PDS.pdf

 

 

 

Additional supporting documents, including COA and MSDS are available upon request.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.