PSCA (prostate stem cell antigen) is a glycosylphosphatidylinositol (GPI)-anchored cell membrane glycoprotein of the UPAR/Ly6 family.  A variety of GPI-linked surface glycoproteins are composed of one or more copies of a conserved domain of ~100 amino-acid residues termed UPAR/Ly6 motif that was originally found in UPAR (Urokinase plasminogen activator surface receptor) and Ly6/CD59.  PSCA contains one UPAR/Ly6 domain in the extracellular domain (ECD). Mature human PSCA (amino acids 21-95) shares ~65% amino acid sequence identity with rodent PSCA.  PSCA may be involved in the regulation of cell proliferation with a cell-proliferation inhibition activity in vitro.  PSCA may be up- or down-regulated in cancer and may promote or suppress the tumor, depending on location. In addition to being highly expressed in the prostate, PSCA is also expressed in the bladder, placenta, colon, kidney, and stomach. PSCA is up-regulated in a large proportion of prostate cancers and is also detected in cancers of the bladder and pancreas. The PSCA gene includes a polymorphism that results in an upstream start codon in some individuals; this polymorphism is thought to be associated with a risk for certain gastric and bladder cancers. 

PSCA (prostate stem cell antigen) is a glycosylphosphatidylinositol (GPI)-anchored cell membrane glycoprotein of the UPAR/Ly6 family.  A variety of GPI-linked surface glycoproteins are composed of one or more copies of a conserved domain of ~100 amino-acid residues termed UPAR/Ly6 motif that was originally found in UPAR (Urokinase plasminogen activator surface receptor) and Ly6/CD59.  PSCA contains one UPAR/Ly6 domain in the extracellular domain (ECD). Mature human PSCA (amino acids 21-95) shares ~65% amino acid sequence identity with rodent PSCA.  PSCA may be involved in the regulation of cell proliferation with a cell-proliferation inhibition activity in vitro.  PSCA may be up- or down-regulated in cancer and may promote or suppress the tumor, depending on location. In addition to being highly expressed in the prostate, PSCA is also expressed in the bladder, placenta, colon, kidney, and stomach. PSCA is up-regulated in a large proportion of prostate cancers and is also detected in cancers of the bladder and pancreas. The PSCA gene includes a polymorphism that results in an upstream start codon in some individuals; this polymorphism is thought to be associated with a risk for certain gastric and bladder cancers. 

Product Details

 

Gene Symbol: PSCA; UNQ206/PRO232

 

NCBI Gene ID: 8000

 

Uniprot Entry: O43653

 

Construct Details: Full length human PSCA gene (encoding UniProt #O43653) is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter and with or without a selection marker, which can be used for both transient and stable expression in mammalian cells.  It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles. Multiple choices of a stable antibiotic selection marker are available.

 

Vector Type: pLTC or pLTC-IRES-Marker (lentiviral expression vector containing a heterologous CMV promoter +/- a selection marker, see the vector map above)

 

Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)

 

Gene Insert Size: 372(bp)

 

Gene Insert Sequence:  

ATGAAGGCTGTGCTGCTTGCCCTGTTGATGGCAGGCTTGGCCCTGCAGCCAGGCACTGCCCTGCTGTGCTACTCCTGCAA

AGCCCAGGTGAGCAACGAGGACTGCCTGCAGGTGGAGAACTGCACCCAGCTGGGGGAGCAGTGCTGGACCGCGCGCATCC

GCGCAGTTGGCCTCCTGACCGTCATCAGCAAAGGCTGCAGCTTGAACTGCGTGGATGACTCACAGGACTACTACGTGGGC

AAGAAGAACATCACGTGCTGTGACACCGACTTGTGCAACGCCAGCGGGGCCCATGCCCTGCAGCCGGCTGCCGCCATCCT

TGCGCTGCTCCCTGCACTCGGCCTGCTGCTCTGGGGACCCGGCCAGCTATAG

 

 

Primers: Gene insert coding sequence can be confirmed by following primers:

(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;

(b) reverse (or 3'-end) primer: 5’-CCAGGTTTCCGGGCCCTCAC-3’

 

 

Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification.  High fidelity PCR systems should always be used. 

 

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Storage

 

The product is shipped at 4°C. Upon receipt, centrifuge the product briefly before opening the vial. It is recommended to store small aliquots at the temperature below –20°C for long-term storage and the product is stable for 6 months. 

 

 

Use a manual defrost freezer and avoid repeated freeze-thaw cycles.

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

 

References

 

1. Proc. Natl. Acad. Sci. 95:1735 (1998)

2. Biochem. Biophys. Res. Commun. 275:783 (2000)

3. Oncogene 19:1288 (2000)

4. Nat. Genet. 40:730 (2008)

 

 

 

Documentation

 

Product datasheet (pdf) can be downloaded here: LTP2506-PDS.pdf

 

 

 

Additional supporting documents, including COA and MSDS are available upon request.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.