BAFFR (B- cell-activating factor receptor), also known as CD268 and BR3 (BLyS receptor 3), is a single-pass type III transmembrane glycoprotein in the tumor necrosis factor receptor superfamily (TNFRSF13C).  BAFFR contains only one partial TNFR cysteine-rich repeat with 4 cysteine residues in the extracellular region but lacks a cytoplasmic death domain (DD). BAFFR is highly expressed in spleen and lymph node, and in resting B-cells. BAFFR is detected at lower levels in activated B-cells, resting T-cells, in thymus and peripheral blood leukocytes. BAFFR is a B-cell receptor specific for the TNF superfamily ligand, BAFF /TNFSF13B. BAFF promotes the survival of B cells and is essential for B cell maturation.  BAFF binds to3 TNFRSF members: BCMA (B­cell maturation antigen - TNFRSF17), TACI (transmembrane activator and calcium­modulator and cyclophilin ligand interactor -TNFRSF13B) and BAFFR. TACI and BCMA bind BAFF and another TNFSF ligand, APRIL (a proliferation­inducing ligand). In contrast, BAFFR selectively binds BAFF. BAFF knockout mice lack mature B cells while BCMA­ or TACI­deficient mice have no major defect in B­cell development. Mutations in the BAFFR gene are associated with immunodeficiency common variable type 4 (CVID4), which is a primary immunodeficiency characterized by antibody deficiency, hypogammaglobulinemia, recurrent bacterial infections and an inability to mount an antibody response to antigen. CVID4 results from a failure of B-cell differentiation and impaired secretion of immunoglobulins.

BAFFR (B- cell-activating factor receptor), also known as CD268 and BR3 (BLyS receptor 3), is a single-pass type III transmembrane glycoprotein in the tumor necrosis factor receptor superfamily (TNFRSF13C).  BAFFR contains only one partial TNFR cysteine-rich repeat with 4 cysteine residues in the extracellular region but lacks a cytoplasmic death domain (DD). BAFFR is highly expressed in spleen and lymph node, and in resting B-cells. BAFFR is detected at lower levels in activated B-cells, resting T-cells, in thymus and peripheral blood leukocytes. BAFFR is a B-cell receptor specific for the TNF superfamily ligand, BAFF /TNFSF13B. BAFF promotes the survival of B cells and is essential for B cell maturation.  BAFF binds to3 TNFRSF members: BCMA (B­cell maturation antigen - TNFRSF17), TACI (transmembrane activator and calcium­modulator and cyclophilin ligand interactor -TNFRSF13B) and BAFFR. TACI and BCMA bind BAFF and another TNFSF ligand, APRIL (a proliferation­inducing ligand). In contrast, BAFFR selectively binds BAFF. BAFF knockout mice lack mature B cells while BCMA­ or TACI­deficient mice have no major defect in B­cell development. Mutations in the BAFFR gene are associated with immunodeficiency common variable type 4 (CVID4), which is a primary immunodeficiency characterized by antibody deficiency, hypogammaglobulinemia, recurrent bacterial infections and an inability to mount an antibody response to antigen. CVID4 results from a failure of B-cell differentiation and impaired secretion of immunoglobulins.

  

Product Details

 

Gene Symbol: TNFRSF13C; CD268; BR3; CVID4; BAFF-R; BROMIX; prolixin

 

NCBI Gene ID: 115650

 

Uniprot Entry: Q96RJ3

 

Construct Details: Full length human BAFFR/CD268 gene is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter, which can be used for both transient and stable expression in mammalian cells.  It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles.

 

Vector Type: pLTC (lentiviral expression vector containing a heterologous CMV promoter, see the vector map above)

 

Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)

 

Gene Insert Sequence:  

ATGAGGCGAGGGCCCCGGAGCCTGCGGGGCAGGGACGCGCCAGCCCCCACGCCCTGCGTCCCGGCCGAGTGCTTCGACCT

GCTGGTCCGCCACTGCGTGGCCTGCGGGCTCCTGCGCACGCCGCGGCCGAAACCGGCCGGGGCCAGCAGCCCTGCGCCCA

GGACGGCGCTGCAGCCGCAGGAGTCGGTGGGCGCGGGGGCCGGCGAGGCGGCGCTGCCCCTGCCCGGGCTGCTCTTTGGC

GCCCCCGCGCTGCTGGGCCTGGCACTGGTCCTGGCGCTGGTCCTGGTGGGTCTGGTGAGCTGGAGGCGGCGACAGCGGCG

GCTTCGCGGCGCGTCCTCCGCAGAGGCCCCCGACGGAGACAAGGACGCCCCAGAGCCCCTGGACAAGGTCATCATTCTGT

CTCCGGGAATCTCTGATGCCACAGCTCCTGCCTGGCCTCCTCCTGGGGAAGACCCAGGAACCACCCCACCTGGCCACAGT

GTCCCTGTGCCAGCCACAGAGCTGGGCTCCACTGAACTGGTGACCACCAAGACGGCCGGCCCTGAGCAACAATAG

 

Primers: Gene insert coding sequence can be confirmed by following primers:

(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;

(b) reverse (or 3'-end) primer: 5’-CGGGAAGCAATAGCATGATA-3’

 

 

Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification.  High fidelity PCR systems should always be used. 

 

  

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Storage

 

The product is shipped at 4°C. Upon receipt, centrifuge the product briefly before opening the vial. It is recommended to store small aliquots at the temperature below –20°C for long-term storage and the product is stable for 6 months. 

 

  

 

Use a manual defrost freezer and avoid repeated freeze-thaw cycles.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

 

References

 

1. Science 14:2108 (2001).

2. Current Biol. 11:R1013 (2001).

3. Nat. Rev. Immunol. 2:464 (2002).

4. Curr. Opin. Immunol. 14:266 (2002).

5. Adv. Cancer Res.86: 195 (2003). 

 

 

 

Documentation

 

Product datasheet (pdf) can be downloaded here: LTP0108-PDS.pdf

 

 

 

Additional supporting documents, including COA and MSDS are available upon request.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.