Programmed death-1 (PD-1), also known as programmed cell death 1 (PDCD1) or CD279, is a single pass type I transmembrane glycoprotein of the Ig superfamily. It is an immunoreceptor in the CD28/CTLA-4 family with an IgV-type extracellular domain showing 21–33% sequence identity with CTLA-4, CD28 and ICOS.  Members of the CD28/CTLA-4 family have been shown to either promote T cell activation (CD28 and ICOS) or inhibit T cell activation (CTLA­4 and PD­1).  The cytoplasmic domain of PD-1 contains two tyrosine residues, a membrane-proximal immunoreceptor tyrosine-based inhibitory motif (ITIM) and an immunoreceptor tyrosine-based switch motif (ITSM). ITIM is widely found in immunoinhibitory receptors and the membrane-proximal tyrosine residue may play a central role for the inhibitory function of PD-1. PD-1 negatively regulates antigen receptor signaling by recruiting protein tyrosine phosphatase upon engaging with either of two ligands, PD-L1 or PD-L2. It inhibits the T-cell proliferation and production of related cytokines such as IL-1, IL-4, IL-10 and IFN-γ. PD-1 is involved in lymphocyte clonal selection and peripheral tolerance, and thus contributes to the prevention of autoimmune diseases. As a negative regulator of T- cell effector mechanisms, PD-1 may lead to suppression of anti-tumor immunity. Blockade of PD-1 inhibitory activity with antibodies enhances anti-tumor immunity in vivo.  PD-1 has been proposed as a promising target for cancer immunotherapy.

Programmed death-1 (PD-1), also known as programmed cell death 1 (PDCD1) or CD279, is a single pass type I transmembrane glycoprotein of the Ig superfamily. It is an immunoreceptor in the CD28/CTLA-4 family with an IgV-type extracellular domain showing 21–33% sequence identity with CTLA-4, CD28 and ICOS.  Members of the CD28/CTLA-4 family have been shown to either promote T cell activation (CD28 and ICOS) or inhibit T cell activation (CTLA­4 and PD­1).  The cytoplasmic domain of PD-1 contains two tyrosine residues, a membrane-proximal immunoreceptor tyrosine-based inhibitory motif (ITIM) and an immunoreceptor tyrosine-based switch motif (ITSM). ITIM is widely found in immunoinhibitory receptors and the membrane-proximal tyrosine residue may play a central role for the inhibitory function of PD-1. PD-1 negatively regulates antigen receptor signaling by recruiting protein tyrosine phosphatase upon engaging with either of two ligands, PD-L1 or PD-L2. It inhibits the T-cell proliferation and production of related cytokines such as IL-1, IL-4, IL-10 and IFN-γ. PD-1 is involved in lymphocyte clonal selection and peripheral tolerance, and thus contributes to the prevention of autoimmune diseases. As a negative regulator of T- cell effector mechanisms, PD-1 may lead to suppression of anti-tumor immunity. Blockade of PD-1 inhibitory activity with antibodies enhances anti-tumor immunity in vivo.  PD-1 has been proposed as a promising target for cancer immunotherapy.

 

Product Details

 

Gene Symbol: PD-1, CD279, PDCD1, PD1,  SLEB2, mkPD1, mkPD-1

 

NCBI Gene ID: 100135775

 

Uniprot Entry: B0LAJ2 

 

Construct Details: Full length monkey PD-1 or CD279 gene is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter -/+ an antibiotics selection marker, which can be used for both transient and stable expression in mammalian cells.  It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles. Multiple selection markers are available.

 

Vector Type: pLTC or pLTC-Marker (lentiviral expression vector containing a heterologous CMV promoter, see the vector map above)

 

Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)

 

Gene Insert Size: 867 (bp)

 

Gene Insert Sequence:  

ATGCAGATCCCACAGGCACCCTGGCCGGTCGTCTGGGCGGTGCTACAACTGGGCTGGCGGCCAGGATGGTTCTTAGAATC

CCCGGACAGGCCCTGGAACCCCCCCACCTTCTCCCCAGCCCTGCTCCTGGTGACCGAAGGAGACAACGCCACCTTCACCT

GCAGCTTCTCCAACGCCTCGGAGAGCTTCGTGCTGAACTGGTACCGCATGAGCCCCAGCAACCAGACGGACAAGCTGGCT

GCCTTCCCCGAGGACCGCAGCCAGCCCGGCCGGGACTGCCGCTTCCGCGTCACACAACTGCCCAACGGGCGCGACTTCCA

CATGAGCGTGGTCAGGGCCCGGCGCAACGACAGCGGCACCTACCTCTGCGGGGCCATCTCCCTGGCCCCCAAGGCGCAGA

TCAAAGAGAGCCTGCGGGCAGAGCTCAGGGTGACAGAGAGAAGGGCAGAAGTGCCCACAGCCCACCCCAGCCCCTCACCC

AGGCCAGCTGGCCAGTTCCAAGCCCTGGTGGTTGGTGTCGTGGGCGGCCTGCTGGGCAGCCTGGTGCTGCTAGTCTGGGT

CCTGGCTGTCATCTGCTCCCGGGCTGCACAAGGGACCATAGAAGCCAGGCGCACCGGCCAGCCCCTGAAGGAGGACCCCT

CGGCCGTGCCTGTGTTCTCTGTGGACTATGGGGAGCTGGATTTCCAGTGGCGAGAGAAGACCCCGGAGCCCCCGGCACCC

TGTGTCCCTGAGCAGACGGAGTACGCCACCATCGTCTTTCCTAGTGGGCTGGGCACCTCGTCCCCGGCCCGCAGGGGCTC

AGCCGACGGCCCTCGGAGTCCCCGGCCACTGAGGCCTGAGGATGGACACTGCTCTTGGCCCCTCTGA

 

Primers: Gene insert coding sequence can be confirmed by following primers:

(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;

(b) reverse (or 3'-end) primer: 5’-CGGGAAGCAATAGCATGATA-3’

 

 

Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification.  High fidelity PCR systems should always be used. 

 

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Storage

 

The product is shipped at 4°C. Upon receipt, centrifuge the product briefly before opening the vial. It is recommended to store small aliquots at the temperature below –20°C for long-term storage and the product is stable for 6 months. 

 

 

Use a manual defrost freezer and avoid repeated freeze-thaw cycles.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

 

References

 

1. EMBO J. 11:3887, 1992   

2. Genomics 23:704-706, 1994

3. Genes Immun. 6:430-437, 2005

4. Immunol. Rev. 229:114-25, 2009

 

 

 

 

Additional supporting documents, including PDS, COA and MSDS are available upon request.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.