CD28 is a single-pass type I transmembrane glycoprotein that belongs to the CD28/CTLA4 (cytotoxic T lymphocyte-associated antigen 4, also known as CD152) family of the immunoglobulin (Ig) superfamily. CD28 and CTLA-4 are structurally homologous molecules and both contain one Ig-like V-type domain in the extracellular region. CD28 and CTLA4 are expressed on the cell surface as disulfide­linked homodimers or as monomers. Together with their ligands, CD80 and CD86, they constitute one of the dominant co-stimulatory pathways that regulate T and B cell responses. CD28 is expressed in T-cells and plasma cells, but not in less mature B-cells. CD28 is involved in T-cell activation, the induction of cell proliferation and cytokine production and promotion of T-cell survival.  CD28 is expressed constitutively on nearly all mouse T cells and surface expression is down­regulated upon ligation of CD28. CTLA­4 is not constitutively expressed but is up­regulated rapidly following T cell activation and CD28 ligation. The binding of CD80 and CD86 to its receptor CD28 induces T-cell proliferation and cytokine production. CD28 ligation has also been shown to regulate Th1/Th2 differentiation. CTLA4 binds to CD80 and CD86 with a 20-100 fold higher affinity than CD28 and is involved in the downregulation of the immune response. The CD80/CD86/CD28/CTLA4 pathway can positively and negatively regulate immune responses. CD28 is thus regarded as a promising therapeutic target for autoimmune diseases and cancer.

CD28 is a single-pass type I transmembrane glycoprotein that belongs to the CD28/CTLA4 (cytotoxic T lymphocyte-associated antigen 4, also known as CD152) family of the immunoglobulin (Ig) superfamily. CD28 and CTLA-4 are structurally homologous molecules and both contain one Ig-like V-type domain in the extracellular region. CD28 and CTLA4 are expressed on the cell surface as disulfide­linked homodimers or as monomers. Together with their ligands, CD80 and CD86, they constitute one of the dominant co-stimulatory pathways that regulate T and B cell responses. CD28 is expressed in T-cells and plasma cells, but not in less mature B-cells. CD28 is involved in T-cell activation, the induction of cell proliferation and cytokine production and promotion of T-cell survival.  CD28 is expressed constitutively on nearly all mouse T cells and surface expression is down­regulated upon ligation of CD28. CTLA­4 is not constitutively expressed but is up­regulated rapidly following T cell activation and CD28 ligation. The binding of CD80 and CD86 to its receptor CD28 induces T-cell proliferation and cytokine production. CD28 ligation has also been shown to regulate Th1/Th2 differentiation. CTLA4 binds to CD80 and CD86 with a 20-100 fold higher affinity than CD28 and is involved in the downregulation of the immune response. The CD80/CD86/CD28/CTLA4 pathway can positively and negatively regulate immune responses. CD28 is thus regarded as a promising therapeutic target for autoimmune diseases and cancer.

 

Product Details

 

Gene Symbol: CD28; TP44; TP-44

 

NCBI Gene ID: 940

 

Uniprot Entry: P10747

 

Construct Details: Full length human CD28 gene is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter, which can be used for both transient and stable expression in mammalian cells.  It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles.

 

Vector Type: pLTC (lentiviral expression vector containing a heterologous CMV promoter, see the vector map above)

 

Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)

 

Gene Insert Size: 663 (bp)

 

Gene Insert Sequence:  

ATGCTCAGGCTGCTCTTGGCTCTCAACTTATTCCCTTCAATTCAAGTAACAGGAAACAAGATTTTGGTGAAGCAGTCGCC

CATGCTTGTAGCGTACGACAATGCGGTCAACCTTAGCTGCAAGTATTCCTACAATCTCTTCTCAAGGGAGTTCCGGGCAT

CCCTTCACAAAGGACTGGATAGTGCTGTGGAAGTCTGTGTTGTATATGGGAATTACTCCCAGCAGCTTCAGGTTTACTCA

AAAACGGGGTTCAACTGTGATGGGAAATTGGGCAATGAATCAGTGACATTCTACCTCCAGAATTTGTATGTTAACCAAAC

AGATATTTACTTCTGCAAAATTGAAGTTATGTATCCTCCTCCTTACCTAGACAATGAGAAGAGCAATGGAACCATTATCC

ATGTGAAAGGGAAACACCTTTGTCCAAGTCCCCTATTTCCCGGACCTTCTAAGCCCTTTTGGGTGCTGGTGGTGGTTGGT

GGAGTCCTGGCTTGCTATAGCTTGCTAGTAACAGTGGCCTTTATTATTTTCTGGGTGAGGAGTAAGAGGAGCAGGCTCCT

GCACAGTGACTACATGAACATGACTCCCCGCCGCCCCGGGCCCACCCGCAAGCATTACCAGCCCTATGCCCCACCACGCG

ACTTCGCAGCCTATCGCTCCTGA

 

Primers: Gene insert coding sequence can be confirmed by following primers:

(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;

(b) reverse (or 3'-end) primer: 5’-CGGGAAGCAATAGCATGATA-3’

 

 

Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification.  High fidelity PCR systems should always be used. 

 

  

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Storage

 

The product is shipped at 4°C. Upon receipt, centrifuge the product briefly before opening the vial. It is recommended to store small aliquots at the temperature below –20°C for long-term storage and the product is stable for 6 months. 

 

 

 

Use a manual defrost freezer and avoid repeated freeze-thaw cycles.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

 

References

 

1. Annu Rev Immunol. 11 :191-212 (1993).

2. Advances in Immunol. 62:131 (1996). 

3. Biochem. J. 318:361 (1996). 

4. Blood 99:2138-2145(2002) 

5. Nat. Immunol. 6:271-279(2005)

 

 

 

Documentation

 

Product datasheet (pdf) can be downloaded here: LTP0712-PDS.pdf

 

 

 

Additional supporting documents, including COA and MSDS are available upon request.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.