There are 3 classes of receptors for the Fc region of IgG (FcγRs): FcγRI (CD64), FcγRII (CD32), and FcγRIII (CD16), each with multiple isoforms.  All these receptors are members of the Ig superfamily (IgSF) and they play important roles in the activation or inhibition of immune responses. FcγRI is a high-affinity receptor for IgG while both FcγRII and FcγRIII are low-affinity receptors that bind IgG in the form of immune complexes.  There are two genes for human FcγRIII: the FcγRIIIA (CD16A) gene that encodes a transmembrane receptor and the FcγRIIIB (CD16B) gene that encodes a glycosylphosphatidylinositol (GPI)-anchored protein. The extracellular domains (ECDs) of CD16A and CD16B share 97% amino acid sequence homology. Three allelic variants of CD16B, NA-1, NA-2, and SH, exist. Whereas CD16A is expressed on most effector cells of the immune system including macrophage, monocyte, NK cells, mast cells, eosinophils, dendritic cells and Langerhans cells, CD16B is selectively expressed in neutrophils and eosinophils. Signaling through CD16A results in oxidative burst, cytokine release and phagocytosis by macrophages, antibody-dependent cellular cytotoxicity by natural killer cells and degranulation of mast cells. By contrast, CD16B is a decoy receptor that binds IgG in complexes without triggering activation. A soluble form of CD16B can be produced by proteolytic cleavage and circulates in plasma and other body fluids. Soluble CD16B interacts with complement receptors CR3 and CR4 on monocytes to induce the production of pro-inflammatory cytokines.

There are 3 classes of receptors for the Fc region of IgG (FcγRs): FcγRI (CD64), FcγRII (CD32), and FcγRIII (CD16), each with multiple isoforms.  All these receptors are members of the Ig superfamily (IgSF) and they play important roles in the activation or inhibition of immune responses. FcγRI is a high-affinity receptor for IgG while both FcγRII and FcγRIII are low-affinity receptors that bind IgG in the form of immune complexes.  There are two genes for human FcγRIII: the FcγRIIIA (CD16A) gene that encodes a transmembrane receptor and the FcγRIIIB (CD16B) gene that encodes a glycosylphosphatidylinositol (GPI)-anchored protein. The extracellular domains (ECDs) of CD16A and CD16B share 97% amino acid sequence homology. Three allelic variants of CD16B, NA-1, NA-2, and SH, exist. Whereas CD16A is expressed on most effector cells of the immune system including macrophage, monocyte, NK cells, mast cells, eosinophils, dendritic cells and Langerhans cells, CD16B is selectively expressed in neutrophils and eosinophils. Signaling through CD16A results in oxidative burst, cytokine release and phagocytosis by macrophages, antibody-dependent cellular cytotoxicity by natural killer cells and degranulation of mast cells. By contrast, CD16B is a decoy receptor that binds IgG in complexes without triggering activation. A soluble form of CD16B can be produced by proteolytic cleavage and circulates in plasma and other body fluids. Soluble CD16B interacts with complement receptors CR3 and CR4 on monocytes to induce the production of pro-inflammatory cytokines.

 

Product Details

 

Gene Symbol: CD16b; FCGR3B; FCG3; CD16; FCGR3; FCR-10; FCRIII; FCRIIIb

 

NCBI Gene ID: 2215

 

Uniprot Entry: O75015

 

Construct Details: Full length human CD16B/FCGR3B gene (encoding UniProt #O75015) is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter and with or without a selection marker, which can be used for both transient and stable expression in mammalian cells.  It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles. Multiple choices of a stable antibiotic selection marker are available.

 

Vector Type: pLTC or pLTC-IRES-Marker (lentiviral expression vector containing a heterologous CMV promoter +/- a selection marker, see the vector map above)

 

Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)

 

Gene Insert Size: 702 (bp)

 

Gene Insert Sequence:  

ATGTGGCAGCTGCTCCTCCCAACTGCTCTGCTACTTCTAGTTTCAGCTGGCATGCGGACTGAAGATCTCC

CAAAGGCTGTGGTGTTCCTGGAGCCTCAATGGTACAGCGTGCTTGAGAAGGACAGTGTGACTCTGAAGTG

CCAGGGAGCCTACTCCCCTGAGGACAATTCCACACAGTGGTTTCACAATGAGAACCTCATCTCAAGCCAG

GCCTCGAGCTACTTCATTGACGCTGCCACAGTCAACGACAGTGGAGAGTACAGGTGCCAGACAAACCTCT

CCACCCTCAGTGACCCGGTGCAGCTAGAAGTCCATATCGGCTGGCTGTTGCTCCAGGCCCCTCGGTGGGT

GTTCAAGGAGGAAGACCCTATTCACCTGAGGTGTCACAGCTGGAAGAACACTGCTCTGCATAAGGTCACA

TATTTACAGAATGGCAAAGACAGGAAGTATTTTCATCATAATTCTGACTTCCACATTCCAAAAGCCACAC

TCAAAGATAGCGGCTCCTACTTCTGCAGGGGGCTTGTTGGGAGTAAAAATGTGTCTTCAGAGACTGTGAA

CATCACCATCACTCAAGGTTTGGCAGTGTCAACCATCTCATCATTCTCTCCACCTGGGTACCAAGTCTCT

TTCTGCTTGGTGATGGTACTCCTTTTTGCAGTGGACACAGGACTATATTTCTCTGTGAAGACAAACATTT

GA

 

 

Primers: Gene insert coding sequence can be confirmed by following primers:

(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;

(b) reverse (or 3'-end) primer: 5’-CCAGGTTTCCGGGCCCTCAC-3’

 

 

Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification.  High fidelity PCR systems should always be used. 

 

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Storage

 

The product is shipped at 4°C. Upon receipt, centrifuge the product briefly before opening the vial. It is recommended to store small aliquots at the temperature below –20°C for long-term storage and the product is stable for 6 months. 

 

 

Use a manual defrost freezer and avoid repeated freeze-thaw cycles.

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

 

References

 

1. Immunol. Today 14:215 (1993).

2. J Biol Chem. 270 (43): 25762 (1995)

3. J. Immunol. 157:1184 (1996)

4. Annu. Rev. Immunol.19:275 (2001).

5. Nature Rev. Immunol. 2:580 (2002)

 

 

 

Documentation

 

Product datasheet (pdf) can be downloaded here: LTP2536-PDS.pdf

 

 

 

Additional supporting documents, including COA and MSDS are available upon request.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.