Smaller Font Default Font Larger Font

You are here:

PrintEmail

Human SCF/KITL/KITLG/KL/MGF/SLF Gene, Full-length cDNA Clone in Lentivector, Endotoxin-free DNA

Product ID: pLTC-SCF220 (SKU#: LTP2346)

For Bulk Order: Call for price

Price:
$696.00
Size

Selection Marker

Description

SCF (stem cell factor), also known as KITL/KITLG/KL (c­kit ligand), MGF (mast cell growth factor), and steel factor (SLF), is a single-pass type I transmembrane protein belonging to to the SCF family of dimeric transmembrane growth factors. Mature human SCF is composed of a 189 amino acid (aa) extracellular domain (ECD), a 23 aa transmembrane segment, and a 36 aa cytoplasmic tail.  Proteolytic cleavage releases a 25 kDa soluble protein that shows both N­linked and O­linked glycosylation.  SCF is a primary growth factor that promotes the survival, differentiation, and mobilization of multiple cell types, including mast cells, myeloid, erythroid, megakaryocytic, lymphoid, germ cell, eosinophils and melanocytes. For example, mast cell development depends on SCF and its receptor, c-Kit, which is a receptor tyrosine kinase. Mast cells participate in a variety of immune responses, such as parasite resistance and allergic reactions. SCF also increases the proliferation of both myeloid and lymphoid hematopoietic progenitors in bone marrow culture.  The noncovalent dimers of transmembrane or soluble form of SCF interact with c­kit to trigger receptor dimerization and signaling activation. SCF may assist in the recovery of cardiac function following myocardial infarction.  It also plays a crucial role in the development and maintenance of the melanocyte lineage in adult skin with the potential for CSF-dependent treatment of pathological skin conditions. The mutations in SCF associate wih hyperpigmentation with or without hypopigmentation, familial progressive (FPHH).

 

SCF (stem cell factor), also known as KITL/KITLG/KL (c­kit ligand), MGF (mast cell growth factor), and steel factor (SLF), is a single-pass type I transmembrane protein belonging to to the SCF family of dimeric transmembrane growth factors. Mature human SCF is composed of a 189 amino acid (aa) extracellular domain (ECD), a 23 aa transmembrane segment, and a 36 aa cytoplasmic tail.  Proteolytic cleavage releases a 25 kDa soluble protein that shows both N­linked and O­linked glycosylation.  SCF is a primary growth factor that promotes the survival, differentiation, and mobilization of multiple cell types, including mast cells, myeloid, erythroid, megakaryocytic, lymphoid, germ cell, eosinophils and melanocytes. For example, mast cell development depends on SCF and its receptor, c-Kit, which is a receptor tyrosine kinase. Mast cells participate in a variety of immune responses, such as parasite resistance and allergic reactions. SCF also increases the proliferation of both myeloid and lymphoid hematopoietic progenitors in bone marrow culture.  The noncovalent dimers of transmembrane or soluble form of SCF interact with c­kit to trigger receptor dimerization and signaling activation. SCF may assist in the recovery of cardiac function following myocardial infarction.  It also plays a crucial role in the development and maintenance of the melanocyte lineage in adult skin with the potential for CSF-dependent treatment of pathological skin conditions. The mutations in SCF associate wih hyperpigmentation with or without hypopigmentation, familial progressive (FPHH).

 

Product Details

 

Gene Symbol: SCF; KITLG; SF; SLF; MGF; FPH2; FPHH; KL-1; Kitl; SHEP7

 

NCBI Gene ID: 4254

 

Uniprot Entry: P21583

 

Construct Details: Full length human SCF gene encoding UniProt#P21583-2 (SCF220) is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter and with or without a selection marker, which can be used for both transient and stable expression in mammalian cells.  It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles. Multiple choices of a stable antibiotic selection marker are available.

 

Vector Type: pLTC or pLTC-IRES-Marker (lentiviral expression vector containing a heterologous CMV promoter, see the vector map above)

 

Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)

 

Gene Insert Size: 738 (bp)

 

Gene Insert Sequence:  

ATGAAGAAGACACAAACTTGGATTCTCACTTGCATTTATCTTCAGCTGCTCCTATTTAATCCTCTCGTCA

AAACTGAAGGGATCTGCAGGAATCGTGTGACTAATAATGTAAAAGACGTCACTAAATTGGTGGCAAATCT

TCCAAAAGACTACATGATAACCCTCAAATATGTCCCCGGGATGGATGTTTTGCCAAGTCATTGTTGGATA

AGCGAGATGGTAGTACAATTGTCAGACAGCTTGACTGATCTTCTGGACAAGTTTTCAAATATTTCTGAAG

GCTTGAGTAATTATTCCATCATAGACAAACTTGTGAATATAGTGGATGACCTTGTGGAGTGCGTGAAAGA

AAACTCATCTAAGGATCTAAAAAAATCATTCAAGAGCCCAGAACCCAGGCTCTTTACTCCTGAAGAATTC

TTTAGAATTTTTAATAGATCCATTGATGCCTTCAAGGACTTTGTAGTGGCATCTGAAACTAGTGATTGTG

TGGTTTCTTCAACATTAAGTCCTGAGAAAGGGAAGGCCAAAAATCCCCCTGGAGACTCCAGCCTACACTG

GGCAGCCATGGCATTGCCAGCATTGTTTTCTCTTATAATTGGCTTTGCTTTTGGAGCCTTATACTGGAAG

AAGAGACAGCCAAGTCTTACAAGGGCAGTTGAAAATATACAAATTAATGAAGAGGATAATGAGATAAGTA

TGTTGCAAGAGAAAGAGAGAGAGTTTCAAGAAGTGTAA

 

 

Primers: Gene insert coding sequence can be confirmed by following primers:

(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;

(b) reverse (or 3'-end) primer: 5’-CCAGGTTTCCGGGCCCTCAC-3’

 

 

Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification.  High fidelity PCR systems should always be used. 

 

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Storage

 

The product is shipped at 4°C. Upon receipt, centrifuge the product briefly before opening the vial. It is recommended to store small aliquots at the temperature below –20°C for long-term storage and the product is stable for 6 months. 

 

 

Use a manual defrost freezer and avoid repeated freeze-thaw cycles.

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

 

References

 

1. Cell 63:203 (1990)

2. J. Biol. Chem. 266:18942 (1991)

3. Proc. Natl. Acad. Sci. 88:4671 (1991)

4. Blood. 99: 1866 (2002)

5. Pigment Cell Res.16: 287 (2003)

6. Cardiovasc. Res. 70:117 (2006)

 

 

 

Documentation

 

Product datasheet (pdf) can be downloaded here: LTP2346-PDS.pdf

 

 

 

Additional supporting documents, including COA and MSDS are available upon request.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Gene Synonym SCF; KITLG; SF; SLF; MGF; FPH2; FPHH; KL-1; Kitl; SHEP7
Gene Family SCF Family
Research Area Stem Cell
"A" - "Z" List
S
Pathway/Disease KIT signaling
Species
Human
Molecule Class 1-Pass Type I Transmembrane

Search Products

Categories
Molecule Class
Gene Family
Pathway/Disease
Research Area
CD Antigen
"A" - "Z" List
Reset All

Special Offers & Rewards

Promotion

Earn discounts, credits or rewards with your purchases.

Purchase or Clone My Genes

My Gene Clones

Get the sequence-verified, expression-ready gene clones.

Recombinant Proteins

Recombinant Proteins

Oder your high-quality, recombinant proteins of interest.

Recombinant Antibodies

Recombinant Antibodies

Try our products & services for your antibody R&D.

Virus-Based Gene Expression

Virus Gene Delivery

Acquire high titer, ready-to-use viral particles.

Get in Touch with Us

Send your question or feedback on our products & services