EPCAM (Epithelial Cellular Adhesion Molecule), also known as CD326, EGP, KS1/4, KSA, gp40, GA733­2, 17­1A, MIC18 and TROP-1, is a single-pass type I transmembrane glycoprotein.  It is composed of a 242 amino acid (aa) extracellular domain (ECD) with 2 EGF-like repeats, a transmembrane domain, and a 26 aa cytoplasmic domain. EPCAM is expressed on most normal epithelial cells and functions as a homotypic calcium-independent cell adhesion molecule. Homophilic adhesion via EpCAM requires the interaction of both EGF-like repeats, with the first EGF-like repeat mediating reciprocal interaction between EpCAM molecules on opposing cells, while the second repeat is involved in lateral interaction of EpCAM. Lateral interaction of EpCAM lead to the formation of dimers and tetramers. EPCAM may act as a physical homophilic interaction molecule at the mucosal epithelium for providing immunological barrier as a first line of defense against mucosal infection. It also plays a role in embryonic stem cells proliferation and differentiation. EpCAM expression has been found to increase in actively proliferating epithelia tissues and during adult liver regeneration. EpCAM expression is increased in human malignant neoplasias, with most carcinoma expressing EpCAM. Mutations in this gene result in congenital tufting enteropathy. EPCAM is a target for immunotherapy treatment of human carcinomas. 

EPCAM (Epithelial Cellular Adhesion Molecule), also known as CD326, EGP, KS1/4, KSA, gp40, GA733­2, 17­1A, MIC18 and TROP-1, is a single-pass type I transmembrane glycoprotein.  It is composed of a 242 amino acid (aa) extracellular domain (ECD) with 2 EGF-like repeats, a transmembrane domain, and a 26 aa cytoplasmic domain. EPCAM is expressed on most normal epithelial cells and functions as a homotypic calcium-independent cell adhesion molecule. Homophilic adhesion via EpCAM requires the interaction of both EGF-like repeats, with the first EGF-like repeat mediating reciprocal interaction between EpCAM molecules on opposing cells, while the second repeat is involved in lateral interaction of EpCAM. Lateral interaction of EpCAM lead to the formation of dimers and tetramers. EPCAM may act as a physical homophilic interaction molecule at the mucosal epithelium for providing immunological barrier as a first line of defense against mucosal infection. It also plays a role in embryonic stem cells proliferation and differentiation. EpCAM expression has been found to increase in actively proliferating epithelia tissues and during adult liver regeneration. EpCAM expression is increased in human malignant neoplasias, with most carcinoma expressing EpCAM. Mutations in this gene result in congenital tufting enteropathy. EPCAM is a target for immunotherapy treatment of human carcinomas. 

 

Product Details

 

Gene Symbol: CD326; Ep-CAM; ESA; KSA; M4S1; MK-1; DIAR5; EGP-2; EGP40; KS1/4; MIC18; TROP1; EGP314; HNPCC8; TACSTD1

 

NCBI Gene ID: 4072

 

Uniprot Entry: P16422

 

Construct Details: Full length human EPCAM gene is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter and with or without a selection marker, which can be used for both transient and stable expression in mammalian cells.  It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles. Multiple choices of a stable selection marker are available.

 

Vector Type: pLTC or pLTC-IRES-Marker (lentiviral expression vector containing a heterologous CMV promoter, see the vector map above)

 

Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)

 

Gene Insert Size: 945 (bp)

 

Gene Insert Sequence:  

ATGGCGCCCCCGCAGGTCCTCGCGTTCGGGCTTCTGCTTGCCGCGGCGACGGCGACTTTTGCCGCAGCTCAGGAAGAATG

TGTCTGTGAAAACTACAAGCTGGCCGTAAACTGCTTTGTGAATAATAATCGTCAATGCCAGTGTACTTCAGTTGGTGCAC

AAAATACTGTCATTTGCTCAAAGCTGGCTGCCAAATGTTTGGTGATGAAGGCAGAAATGAATGGCTCAAAACTTGGGAGA

AGAGCAAAACCTGAAGGGGCCCTCCAGAACAATGATGGGCTTTATGATCCTGACTGCGATGAGAGCGGGCTCTTTAAGGC

CAAGCAGTGCAACGGCACCTCCATGTGCTGGTGTGTGAACACTGCTGGGGTCAGAAGAACAGACAAGGACACTGAAATAA

CCTGCTCTGAGCGAGTGAGAACCTACTGGATCATCATTGAACTAAAACACAAAGCAAGAGAAAAACCTTATGATAGTAAA

AGTTTGCGGACTGCACTTCAGAAGGAGATCACAACGCGTTATCAACTGGATCCAAAATTTATCACGAGTATTTTGTATGA

GAATAATGTTATCACTATTGATCTGGTTCAAAATTCTTCTCAAAAAACTCAGAATGATGTGGACATAGCTGATGTGGCTT

ATTATTTTGAAAAAGATGTTAAAGGTGAATCCTTGTTTCATTCTAAGAAAATGGACCTGACAGTAAATGGGGAACAACTG

GATCTGGATCCTGGTCAAACTTTAATTTATTATGTTGATGAAAAAGCACCTGAATTCTCAATGCAGGGTCTAAAAGCTGG

TGTTATTGCTGTTATTGTGGTTGTGGTGATAGCAGTTGTTGCTGGAATTGTTGTGCTGGTTATTTCCAGAAAGAAGAGAA

TGGCAAAGTATGAGAAGGCTGAGATAAAGGAGATGGGTGAGATGCATAGGGAACTCAATGCATAA

 

 

Primers: Gene insert coding sequence can be confirmed by following primers:

(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;

(b) reverse (or 3'-end) primer: 5’-CCAGGTTTCCGGGCCCTCAC-3’

 

 

Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification.  High fidelity PCR systems should always be used. 

 

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Storage

 

The product is shipped at 4°C. Upon receipt, centrifuge the product briefly before opening the vial. It is recommended to store small aliquots at the temperature below –20°C for long-term storage and the product is stable for 6 months. 

 

 

Use a manual defrost freezer and avoid repeated freeze-thaw cycles.

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

 

References

 

1. Proc. Natl. Acad. Sci. 87: 2755 (1990) 

2. J. Cell. Biol. 125: 437 (1994)

3. Mol. Cell. Biol. 18:4388 (1998)

4. J. Biol. Chem. 276: 5804 (2001)

5. Cancer. Res. 67: 10831 (2007)

 

 

 

Documentation

 

Product datasheet (pdf) can be downloaded here: LTP2040-PDS.pdf

 

 

 

Additional supporting documents, including COA and MSDS are available upon request.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.