CD79B is also known as B-cell-specific glycoprotein, B29 or immunoglobulin-associated beta (Ig-beta or IGB). CD79B and CD79A form a disulfide-linked heterodimer, which is a part of the B-cell antigen receptor complex (BCR). BCR consists the antigen-specific component, surface Ig, where it non-covalently associates with the CD79 heterodimer.  The CD79 heterodimer is essential for expression and function of BCR.  Like CD79A, CD79B is a single-pass type I transmembrane protein of the Ig superfamily (IgSF).  It contains 1 Ig-like V-type domain in the extracellular domain (ECD) and 1 ITAM motif in the cytoplasmic tail.   CD79B is required in cooperation with CD79A for the initiation of signaling cascade by BCR, which leads to internalization of the complex, trafficking to endosomes and antigen presentation. CD79A and CD79B become phosphorylated on tyrosines upon B-cell activation by SRC-type Tyr-kinases such as BLK, LYN and SYK.  CD79B can enhance phosphorylation of CD79A by recruiting kinases to phosphorylate CD79A or proteins that bind to CD79A and protect it from dephosphorylation.  Mutations in the CD79B gene are associated with Agammaglobulinemia 6, autosomal recessive (AGM6), a primary immunodeficiency characterized by profoundly low or absent serum antibodies and circulating B-cells due to an early blockade of B-cell development. 

CD79B is also known as B-cell-specific glycoprotein, B29 or immunoglobulin-associated beta (Ig-beta or IGB). CD79B and CD79A form a disulfide-linked heterodimer, which is a part of the B-cell antigen receptor complex (BCR). BCR consists the antigen-specific component, surface Ig, where it non-covalently associates with the CD79 heterodimer.  The CD79 heterodimer is essential for expression and function of BCR.  Like CD79A, CD79B is a single-pass type I transmembrane protein of the Ig superfamily (IgSF).  It contains 1 Ig-like V-type domain in the extracellular domain (ECD) and 1 ITAM motif in the cytoplasmic tail.   CD79B is required in cooperation with CD79A for the initiation of signaling cascade by BCR, which leads to internalization of the complex, trafficking to endosomes and antigen presentation. CD79A and CD79B become phosphorylated on tyrosines upon B-cell activation by SRC-type Tyr-kinases such as BLK, LYN and SYK.  CD79B can enhance phosphorylation of CD79A by recruiting kinases to phosphorylate CD79A or proteins that bind to CD79A and protect it from dephosphorylation.  Mutations in the CD79B gene are associated with Agammaglobulinemia 6, autosomal recessive (AGM6), a primary immunodeficiency characterized by profoundly low or absent serum antibodies and circulating B-cells due to an early blockade of B-cell development. 

 

Product Details

 

Gene Symbol: CD79B; B29; IGB; AGM6; Ig-beta

 

NCBI Gene ID: 974

 

Uniprot Entry: P40259

 

Construct Details: Full length human CD79B gene is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter and with or without an antibiotic selection marker, which can be used for both transient and stable expression in mammalian cells.  It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles. Multiple choices of a stable antibiotic selection marker are available.

 

Vector Type: pLTC or pLTC-IRES-Marker (lentiviral expression vector containing a heterologous CMV promoter +/- a selection marker, see the vector map above)

 

Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)

 

Gene Insert Size: 690 (bp)

 

Gene Insert Sequence:  

ATGGCCAGGCTGGCGTTGTCTCCTGTGCCCAGCCACTGGATGGTGGCGTTGCTGCTGCTGCTCTCAGCTG

AGCCAGTACCAGCAGCCAGATCGGAGGACCGGTACCGGAATCCCAAAGGTAGTGCTTGTTCGCGGATCTG

GCAGAGCCCACGTTTCATAGCCAGGAAACGGGGCTTCACGGTGAAAATGCACTGCTACATGAACAGCGCC

TCCGGCAATGTGAGCTGGCTCTGGAAGCAGGAGATGGACGAGAATCCCCAGCAGCTGAAGCTGGAAAAGG

GCCGCATGGAAGAGTCCCAGAACGAATCTCTCGCCACCCTCACCATCCAAGGCATCCGGTTTGAGGACAA

TGGCATCTACTTCTGTCAGCAGAAGTGCAACAACACCTCGGAGGTCTACCAGGGCTGCGGCACAGAGCTG

CGAGTCATGGGATTCAGCACCTTGGCACAGCTGAAGCAGAGGAACACGCTGAAGGATGGTATCATCATGA

TCCAGACGCTGCTGATCATCCTCTTCATCATCGTGCCTATCTTCCTGCTGCTGGACAAGGATGACAGCAA

GGCTGGCATGGAGGAAGATCACACCTACGAGGGCCTGGACATTGACCAGACAGCCACCTATGAGGACATA

GTGACGCTGCGGACAGGGGAAGTGAAGTGGTCTGTAGGTGAGCACCCAGGCCAGGAGTGA

 

Primers: Gene insert coding sequence can be confirmed by following primers:

(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;

(b) reverse (or 3'-end) primer: 5’-CCAGGTTTCCGGGCCCTCAC-3’

 

 

Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification.  High fidelity PCR systems should always be used. 

 

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Storage

 

The product is shipped at 4°C. Upon receipt, centrifuge the product briefly before opening the vial. It is recommended to store small aliquots at the temperature below –20°C for long-term storage and the product is stable for 6 months. 

 

 

Use a manual defrost freezer and avoid repeated freeze-thaw cycles.

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

 

References

 

 

 

Additional supporting documents, including PDS, COA and MSDS are available upon request.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.