SLURP1 (Secreted Ly-6/uPAR-related protein 1) is a secreted glycoprotein of the Ly6/uPAR family. A variety of glycoproteins are composed of one or more copies of a conserved domain of ~100 amino-acid residues termed u-PAR/Ly-6 motif that was originally found in u-PAR (Urokinase plasminogen activator surface receptor) and Ly-6/CD59. The u-PAR/Ly-6 motif has 10 conserved cysteines with a defined disulfide-bonding pattern. SLURP1 contains 1 copy of  u-PAR/Ly6 motifs in the extracellular domain (ECD). SLURP1 has an antitumor activity and is a marker of late differentiation of the skin. SLURP1 is implicated in maintaining the physiological and structural integrity of the keratinocyte layers of the skin. Mutations in the SLURP1 gene have been associated with Mal de Meleda (MDM), a rare autosomal recessive skin disorder. SLURP1 may act as a modulator of nicotinic acetylcholine receptors (nAChRs) activity. In T cells SLURP1 may be involved in regulation of intracellular Ca2+ signaling with a immunomodulatory function in the cornea. It may act as a scavenger receptor for PLAU thereby blocking PLAU-dependent functions of PLAUR such as in cell migration and proliferation.   

SLURP1 (Secreted Ly-6/uPAR-related protein 1) is a secreted glycoprotein of the Ly6/uPAR family. A variety of glycoproteins are composed of one or more copies of a conserved domain of ~100 amino-acid residues termed u-PAR/Ly-6 motif that was originally found in u-PAR (Urokinase plasminogen activator surface receptor) and Ly-6/CD59. The u-PAR/Ly-6 motif has 10 conserved cysteines with a defined disulfide-bonding pattern. SLURP1 contains 1 copy of  u-PAR/Ly6 motifs in the extracellular domain (ECD). SLURP1 has an antitumor activity and is a marker of late differentiation of the skin. SLURP1 is implicated in maintaining the physiological and structural integrity of the keratinocyte layers of the skin. Mutations in the SLURP1 gene have been associated with Mal de Meleda (MDM), a rare autosomal recessive skin disorder. SLURP1 may act as a modulator of nicotinic acetylcholine receptors (nAChRs) activity. In T cells SLURP1 may be involved in regulation of intracellular Ca2+ signaling with a immunomodulatory function in the cornea. It may act as a scavenger receptor for PLAU thereby blocking PLAU-dependent functions of PLAUR such as in cell migration and proliferation.   

 

Product Details

 

Gene Symbol: SLURP1; ARS; MDM; ANUP; ArsB; LY6LS

 

NCBI Gene ID: 57152

 

Uniprot Entry: P55000

 

Construct Details: Full length human SLURP1 gene is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter and with or without a selection marker, which can be used for both transient and stable expression in mammalian cells.  It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles. Multiple choices of a stable antibiotic selection marker are available.

 

Vector Type: pLTC or pLTC-IRES-Marker (lentiviral expression vector containing a heterologous CMV promoter +/- a selection marker, see the vector map above)

 

Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)

 

Gene Insert Size: 312 (bp)

 

Gene Insert Sequence:  

ATGGCCTCTCGCTGGGCTGTGCAGCTGCTGCTCGTGGCAGCCTGGAGCATGGGCTGTGGTGAGGCCCTCA

AGTGCTACACCTGCAAGGAGCCCATGACCAGTGCTTCCTGCAGGACCATTACCCGCTGCAAGCCAGAGGA

CACAGCCTGCATGACCACGCTGGTGACGGTGGAGGCAGAGTACCCCTTCAACCAGAGCCCCGTGGTGACC

CGCTCCTGCTCCAGCTCCTGTGTGGCCACCGACCCCGACAGCATCGGGGCCGCCCACCTGATCTTCTGCT

GCTTCCGAGACCTCTGCAACTCGGAACTCTGA

 

 

Primers: Gene insert coding sequence can be confirmed by following primers:

(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;

(b) reverse (or 3'-end) primer: 5’-CCAGGTTTCCGGGCCCTCAC-3’

 

 

Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification.  High fidelity PCR systems should always be used. 

 

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Storage

 

The product is shipped at 4°C. Upon receipt, centrifuge the product briefly before opening the vial. It is recommended to store small aliquots at the temperature below –20°C for long-term storage and the product is stable for 6 months. 

 

 

Use a manual defrost freezer and avoid repeated freeze-thaw cycles.

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

 

References

 

 

 

 

 

Additional supporting documents, including PDS, COA and MSDS are available upon request.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.