Smaller Font Default Font Larger Font

You are here:

PrintEmail

Human CD24/CD24A Gene, Full-length cDNA in Lentivector, Endotoxin-free DNA

Product ID: pLTC-CD24 (SKU#: LTP2801)

For Bulk Order: Call for price

Price:
$596.00
Size

Selection Marker

Description

CD24 or CD24A is a mucin-type glycosylphosphatidylinositol (GPI)-anchored glycoprotein expressed on the surface of B cells, granulocytes, epithelial, neuronal, and muscle cells, and on a range of tumor cells.  The precursor of CD24 is cleaved to a short 32 amino acid mature peptide that is anchored to the cell surface by GPI. CD24 modulates B-cell activation responses. CD24 promotes antigen-dependent proliferation of B-cells, and prevents their terminal differentiation into antibody-forming cells. Antibody crosslinking of CD24 enhances the induction of apoptosis in B and T cells, which contributes to negative selection and the induction of immune tolerance. CD24 on antigen presenting cells cooperates with B7 molecules in the costimulation of T cells.  CD24 may be a genetic modifier for risk and progression of multiple sclerosis. CD24 serve as a receptor for P-selectin.  CD24 is involved in molecular adhesion and metastatic tumor spread by facilitating the interaction with platelet and endothelial cells. CD24 is considered as a tumor marker and high expressions can be detected in epithelial ovarian cancer, breast cancer, non-small cell lung cancer, prostate cancer and pancreatic cancer. 

 

CD24 or CD24A is a mucin-type glycosylphosphatidylinositol (GPI)-anchored glycoprotein expressed on the surface of B cells, granulocytes, epithelial, neuronal, and muscle cells, and on a range of tumor cells.  The precursor of CD24 is cleaved to a short 32 amino acid mature peptide that is anchored to the cell surface by GPI. CD24 modulates B-cell activation responses. CD24 promotes antigen-dependent proliferation of B-cells, and prevents their terminal differentiation into antibody-forming cells. Antibody crosslinking of CD24 enhances the induction of apoptosis in B and T cells, which contributes to negative selection and the induction of immune tolerance. CD24 on antigen presenting cells cooperates with B7 molecules in the costimulation of T cells.  CD24 may be a genetic modifier for risk and progression of multiple sclerosis. CD24 serve as a receptor for P-selectin.  CD24 is involved in molecular adhesion and metastatic tumor spread by facilitating the interaction with platelet and endothelial cells. CD24 is considered as a tumor marker and high expressions can be detected in epithelial ovarian cancer, breast cancer, non-small cell lung cancer, prostate cancer and pancreatic cancer. 

 

Product Details

 

Gene Symbol: CD24; CD24A

 

NCBI Gene ID: 100133941

 

Uniprot Entry: P25063

 

Construct Details: Full length human CD24 gene is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter and with or without a selection marker, which can be used for both transient and stable expression in mammalian cells.  It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles. Multiple choices of a stable antibiotic selection marker are available.

 

Vector Type: pLTC or pLTC-IRES-Marker (lentiviral expression vector containing a heterologous CMV promoter +/- a selection marker, see the vector map above)

 

Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)

 

Gene Insert Size: 243 (bp)

 

Gene Insert Sequence:  

ATGGGCAGAGCAATGGTGGCCAGGCTCGGGCTGGGGCTGCTGCTGCTGGCACTGCTCCTACCCACGCAGA

TTTATTCCAGTGAAACAACAACTGGAACTTCAAGTAACTCCTCCCAGAGTACTTCCAACTCTGGGTTGGC

CCCAAATCCAACTAATGCCACCACCAAGGCGGCTGGTGGTGCCCTGCAGTCAACAGCCAGTCTCTTCGTG

GTCTCACTCTCTCTTCTGCATCTCTACTCTTAA

 

 

Primers: Gene insert coding sequence can be confirmed by following primers:

(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;

(b) reverse (or 3'-end) primer: 5’-CCAGGTTTCCGGGCCCTCAC-3’

 

 

Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification.  High fidelity PCR systems should always be used. 

 

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Storage

 

The product is shipped at 4°C. Upon receipt, centrifuge the product briefly before opening the vial. It is recommended to store small aliquots at the temperature below –20°C for long-term storage and the product is stable for 6 months. 

 

 

Use a manual defrost freezer and avoid repeated freeze-thaw cycles.

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

 

References

 

1. J. Immunol. 147:1412-1416(1991)

2. Cancer Res. 52:5264-5270(1992)

3. J. Immunol. 166:5567-5577(2001) 

4. Proc. Natl. Acad. Sci. 100:15041-15046(2003) 

 

 

 

Additional supporting documents, including PDS, COA and MSDS are available upon request.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Gene Synonym CD24; CD24A
Gene Family CD24 Family
Research Area Immunology
"A" - "Z" List
C
Pathway/Disease B Cell Activation
Species
Human
CD Antigen CD24
Molecule Class GPI-Anchored Protein

Search Products

Categories
Molecule Class
Gene Family
Pathway/Disease
Research Area
CD Antigen
"A" - "Z" List
Reset All

Special Offers & Rewards

Promotion

Earn discounts, credits or rewards with your purchases.

Purchase or Clone My Genes

My Gene Clones

Get the sequence-verified, expression-ready gene clones.

Recombinant Proteins

Recombinant Proteins

Oder your high-quality, recombinant proteins of interest.

Recombinant Antibodies

Recombinant Antibodies

Try our products & services for your antibody R&D.

Virus-Based Gene Expression

Virus Gene Delivery

Acquire high titer, ready-to-use viral particles.

Get in Touch with Us

Send your question or feedback on our products & services