Smaller Font Default Font Larger Font

You are here:

PrintEmail

Human TSPAN13/NET6/TM4SF13 Gene, Full-length cDNA Clone in Lentivector, Endotoxin-free DNA

Product ID: pLTC-TSPAN13 (SKU#: LTP8020)

For Bulk Order: Call for price

Price:
$696.00
Size

Selection Marker

Description

TSPAN13 is a member of the transmembrane 4 superfamily (TM4SF), also known as the tetraspanin (Tspan) family. Tetraspanins are cell surface glycoproteins with 4 transmembrane (TM) domains, intracellular N- and C-termini and two extracellular domains: one short (termed the small extracellular domain or loop, SED/SEL or EC1) and one longer, typically 100 amino acid residues (the large extracellular domain/loop, LED/LEL or EC2). Although several other protein families have 4 TM domains, tetraspanins are defined by conserved features including 4 or more cysteine residues in the EC2 domain, with 2 in a highly conserved 'CCG' motif. There are 34 tetraspanins in mammals, 33 of which have been identified in humans. The function of specific tetraspanins remains largely unclear. Tetraspanins are often thought to act as scaffolding proteins, anchoring multiple proteins to one area of the cell membrane.  Tetraspanins may function in many cellular processes including differentiation, adhesion, and signal transduction.  They may also contribute to pathological conditions such as metastasis or viral infection. TSPAN7 may have a role in the control of neurite outgrowth by forming a  complex with integrins. TSPAN7 is associated with X-linked mental retardation and neuropsychiatric diseases such as Huntington's chorea, fragile X syndrome and myotonic dystrophy.

 

TSPAN13 is a member of the transmembrane 4 superfamily (TM4SF), also known as the tetraspanin (Tspan) family. Tetraspanins are cell surface glycoproteins with 4 transmembrane (TM) domains, intracellular N- and C-termini and two extracellular domains: one short (termed the small extracellular domain or loop, SED/SEL or EC1) and one longer, typically 100 amino acid residues (the large extracellular domain/loop, LED/LEL or EC2). Although several other protein families have 4 TM domains, tetraspanins are defined by conserved features including 4 or more cysteine residues in the EC2 domain, with 2 in a highly conserved 'CCG' motif. There are 34 tetraspanins in mammals, 33 of which have been identified in humans. The function of specific tetraspanins remains largely unclear. Tetraspanins are often thought to act as scaffolding proteins, anchoring multiple proteins to one area of the cell membrane.  Tetraspanins may function in many cellular processes including differentiation, adhesion, and signal transduction.  They may also contribute to pathological conditions such as metastasis or viral infection. TSPAN7 may have a role in the control of neurite outgrowth by forming a  complex with integrins. TSPAN7 is associated with X-linked mental retardation and neuropsychiatric diseases such as Huntington's chorea, fragile X syndrome and myotonic dystrophy.

 

Product Details

 

Gene Symbol: TSPAN13; NET6; NET-6; TM4SF13; TSPAN-13

 

NCBI Gene ID: 27075

 

Uniprot Entry: O95857

 

Construct Details: Full length human TSPAN13 gene is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter and with or without a selection marker, which can be used for both transient and stable expression in mammalian cells.  It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles. Multiple choices of a stable antibiotic selection marker are available.

 

Vector Type: pLTC or pLTC-IRES-Marker (lentiviral expression vector containing a heterologous CMV promoter +/- a selection marker, see the vector map above)

 

Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)

 

Gene Insert Size: 615 (bp)

 

Gene Insert Sequence:  

ATGGTTTGCGGGGGCTTCGCGTGTTCCAAGAACTGCCTGTGCGCCCTCAACCTGCTTTACACCTTGGTTA

GTCTGCTGCTAATTGGAATTGCTGCGTGGGGCATTGGCTTCGGGCTGATTTCCAGTCTCCGAGTGGTCGG

CGTGGTCATTGCAGTGGGCATCTTCTTGTTCCTGATTGCTTTAGTGGGTCTGATTGGAGCTGTAAAACAT

CATCAGGTGTTGCTATTTTTTTATATGATTATTCTGTTACTTGTATTTATTGTTCAGTTTTCTGTATCTT

GCGCTTGTTTAGCCCTGAACCAGGAGCAACAGGGTCAGCTTCTGGAGGTTGGTTGGAACAATACGGCAAG

TGCTCGAAATGACATCCAGAGAAATCTAAACTGCTGTGGGTTCCGAAGTGTTAACCCAAATGACACCTGT

CTGGCTAGCTGTGTTAAAAGTGACCACTCGTGCTCGCCATGTGCTCCAATCATAGGAGAATATGCTGGAG

AGGTTTTGAGATTTGTTGGTGGCATTGGCCTGTTCTTCAGTTTTACAGAGATCCTGGGTGTTTGGCTGAC

CTACAGATACAGGAACCAGAAAGACCCCCGCGCGAATCCTAGTGCATTCCTTTGA

 

 

Primers: Gene insert coding sequence can be confirmed by following primers:

(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;

(b) reverse (or 3'-end) primer: 5’-CCAGGTTTCCGGGCCCTCAC-3’

 

 

Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification.  High fidelity PCR systems should always be used. 

 

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Storage

 

The product is shipped at 4°C. Upon receipt, centrifuge the product briefly before opening the vial. It is recommended to store small aliquots at the temperature below –20°C for long-term storage and the product is stable for 6 months. 

 

 

Use a manual defrost freezer and avoid repeated freeze-thaw cycles.

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

 

References

 

1. Immunol. Today 15: 588 (1994)

2. J Cell Biol. 155:1103 (2001)

3. Nat. Rev. Mol. Cell Biol. 6: 801 (2005)

4. J Cell Sci 127: 3641 (2014)

 

 

 

 

Additional supporting documents, including datasheet, COA and MSDS are available upon request.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Gene Synonym TSPAN13; NET6; NET-6; TM4SF13; TSPAN-13
Gene Family Tetraspanin/TM4SF Family
Research Area Signal Transduction
"A" - "Z" List
T
Pathway/Disease Cell Differentiation
Species
Human
Molecule Class 4-Pass Transmembrane

Search Products

Categories
Molecule Class
Gene Family
Pathway/Disease
Research Area
CD Antigen
"A" - "Z" List
Reset All

Special Offers & Rewards

Promotion

Earn discounts, credits or rewards with your purchases.

Purchase or Clone My Genes

My Gene Clones

Get the sequence-verified, expression-ready gene clones.

Recombinant Proteins

Recombinant Proteins

Oder your high-quality, recombinant proteins of interest.

Recombinant Antibodies

Recombinant Antibodies

Try our products & services for your antibody R&D.

Virus-Based Gene Expression

Virus Gene Delivery

Acquire high titer, ready-to-use viral particles.

Get in Touch with Us

Send your question or feedback on our products & services