CD9 is a member of the transmembrane 4 superfamily (TM4SF), also known as the tetraspanin (Tspan) family. Tetraspanins are cell surface glycoproteins with 4 transmembrane (TM) domains, intracellular N- and C-termini and two extracellular domains: one short (termed the small extracellular domain or loop, SED/SEL or EC1) and one longer, typically 100 amino acid residues (the large extracellular domain/loop, LED/LEL or EC2). Although several other protein families have 4 TM domains, tetraspanins are defined by conserved features including 4 or more cysteine residues in the EC2 domain, with 2 in a highly conserved 'CCG' motif. There are 34 tetraspanins in mammals, 33 of which have been identified in humans. The function of specific tetraspanins remains largely unclear. Tetraspanins are often thought to act as scaffolding proteins, anchoring multiple proteins to one area of the cell membrane.  Tetraspanins may function in many cellular processes including differentiation, adhesion, and signal transduction.  They may also contribute to pathological conditions such as metastasis or viral infection. CD9 may be involved in platelet activation and aggregation. CD9  may also regulate paranodal junction formation. CD9 is also involved in cell adhesion, cell motility and tumor metastasis and required for sperm-egg fusion.

CD9 is a member of the transmembrane 4 superfamily (TM4SF), also known as the tetraspanin (Tspan) family. Tetraspanins are cell surface glycoproteins with 4 transmembrane (TM) domains, intracellular N- and C-termini and two extracellular domains: one short (termed the small extracellular domain or loop, SED/SEL or EC1) and one longer, typically 100 amino acid residues (the large extracellular domain/loop, LED/LEL or EC2). Although several other protein families have 4 TM domains, tetraspanins are defined by conserved features including 4 or more cysteine residues in the EC2 domain, with 2 in a highly conserved 'CCG' motif. There are 34 tetraspanins in mammals, 33 of which have been identified in humans. The function of specific tetraspanins remains largely unclear. Tetraspanins are often thought to act as scaffolding proteins, anchoring multiple proteins to one area of the cell membrane.  Tetraspanins may function in many cellular processes including differentiation, adhesion, and signal transduction.  They may also contribute to pathological conditions such as metastasis or viral infection. CD9 may be involved in platelet activation and aggregation. CD9  may also regulate paranodal junction formation. CD9 is also involved in cell adhesion, cell motility and tumor metastasis and required for sperm-egg fusion.

 

Product Details

 

Gene Symbol: CD52; CDW52; He5; CAMPATH-1

 

NCBI Gene ID: 928

 

Uniprot Entry: P21926

 

Construct Details: Full length human CD9 gene is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter and with or without a selection marker, which can be used for both transient and stable expression in mammalian cells.  It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles. Multiple choices of a stable antibiotic selection marker are available.

 

Vector Type: pLTC or pLTC-IRES-Marker (lentiviral expression vector containing a heterologous CMV promoter +/- a selection marker, see the vector map above)

 

Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)

 

Gene Insert Size: 687 (bp)

 

Gene Insert Sequence:  

ATGCCGGTCAAAGGAGGCACCAAGTGCATCAAATACCTGCTGTTCGGATTTAACTTCATCTTCTGGCTTG

CCGGGATTGCTGTCCTTGCCATTGGACTATGGCTCCGATTCGACTCTCAGACCAAGAGCATCTTCGAGCA

AGAAACTAATAATAATAATTCCAGCTTCTACACAGGAGTCTATATTCTGATCGGAGCCGGCGCCCTCATG

ATGCTGGTGGGCTTCCTGGGCTGCTGCGGGGCTGTGCAGGAGTCCCAGTGCATGCTGGGACTGTTCTTCG

GCTTCCTCTTGGTGATATTCGCCATTGAAATAGCTGCGGCCATCTGGGGATATTCCCACAAGGATGAGGT

GATTAAGGAAGTCCAGGAGTTTTACAAGGACACCTACAACAAGCTGAAAACCAAGGATGAGCCCCAGCGG

GAAACGCTGAAAGCCATCCACTATGCGTTGAACTGCTGTGGTTTGGCTGGGGGCGTGGAACAGTTTATCT

CAGACATCTGCCCCAAGAAGGACGTACTCGAAACCTTCACCGTGAAGTCCTGTCCTGATGCCATCAAAGA

GGTCTTCGACAATAAATTCCACATCATCGGCGCAGTGGGCATCGGCATTGCCGTGGTCATGATATTTGGC

ATGATCTTCAGTATGATCTTGTGCTGTGCTATCCGCAGGAACCGCGAGATGGTCTAG

 

 

Primers: Gene insert coding sequence can be confirmed by following primers:

(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;

(b) reverse (or 3'-end) primer: 5’-CCAGGTTTCCGGGCCCTCAC-3’

 

 

Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification.  High fidelity PCR systems should always be used. 

 

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Storage

 

The product is shipped at 4°C. Upon receipt, centrifuge the product briefly before opening the vial. It is recommended to store small aliquots at the temperature below –20°C for long-term storage and the product is stable for 6 months. 

 

 

Use a manual defrost freezer and avoid repeated freeze-thaw cycles.

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

 

References

 

1. Immunol. Today 15: 588 (1994)

2. J Cell Biol. 155:1103 (2001)

3. Nat. Rev. Mol. Cell Biol. 6: 801 (2005)

4. J Cell Sci 127: 3641 (2014)

 

 

 

 

Additional supporting documents, including datasheet, COA and MSDS are available upon request.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.