Smaller Font Default Font Larger Font

You are here:

PrintEmail

Mouse Lin28 Full-length Gene in Lentivector, Endotoxin-free DNA

Product ID: pLTE-mLin28 (SKU#: LTE0029)

For Bulk Order: Call for price

Price:
$696.00
Size

Selection Marker

Description

RNA-binding protein Lin-28 is also known as Lin-28A (protein lin-28 homolog A (C. elegans)), ZCCHC1 (Zinc finger CCHC domain-containing protein 1) and CSDD1.  Lin-28 belongs to the Lin-28 family and contains 2 CCHC-type zinc finger and 1 CSD (cold-shock) domains. Lin-28 functions as a translational enhancer that drives specific mRNAs to polysomes and increases the efficiency of protein synthesis. This results in an increased number of initiation events per molecule of mRNA and, indirectly, in mRNA stabilization. Lin28 is expressed in embryonic stem cells, fetal liver, placenta and testis and up-regulated in certain tumors.  Its expression decreases during differentiation of ES cells or upon induction of neuronal differentiation by retinoic acid. Lin-28 binds IGF2 mRNA, MYOD1 mRNA, ARBP ribosomal protein mRNA and its own mRNA. It is essential for skeletal muscle differentiation through the translational up-regulation of IGF2 expression. Lin-28 is a suppressor of microRNA (miRNA) biogenesis, including that of let-7, miR107, miR-143 and miR-200c. It specifically binds miRNA precursors (pre-miRNAs), recognizes a 5'-GGAG-3' motif found in pre-miRNA terminal loop, and recruits ZCCHC11/TUT4 uridylyltransferase, leading to the terminal uridylation of target pre-miRNAs.  Uridylated pre-miRNAs fail to be processed by Dicer and undergo degradation. This may help maintain the pluripotent state by preventing let-7-mediated differentiation of embryonic stem cells. The CSD domain is required for function in muscle differentiation while the CCHC zinc fingers interact with the GGAG motif at the 3' end of let-7 miRNAs precursors. 

RNA-binding protein Lin-28 is also known as Lin-28A (protein lin-28 homolog A (C. elegans)), ZCCHC1 (Zinc finger CCHC domain-containing protein 1) and CSDD1.  Lin-28 belongs to the Lin-28 family and contains 2 CCHC-type zinc finger and 1 CSD (cold-shock) domains. Lin-28 functions as a translational enhancer that drives specific mRNAs to polysomes and increases the efficiency of protein synthesis. This results in an increased number of initiation events per molecule of mRNA and, indirectly, in mRNA stabilization. Lin28 is expressed in embryonic stem cells, fetal liver, placenta and testis and up-regulated in certain tumors.  Its expression decreases during differentiation of ES cells or upon induction of neuronal differentiation by retinoic acid. Lin-28 binds IGF2 mRNA, MYOD1 mRNA, ARBP ribosomal protein mRNA and its own mRNA. It is essential for skeletal muscle differentiation through the translational up-regulation of IGF2 expression. Lin-28 is a suppressor of microRNA (miRNA) biogenesis, including that of let-7, miR107, miR-143 and miR-200c. It specifically binds miRNA precursors (pre-miRNAs), recognizes a 5'-GGAG-3' motif found in pre-miRNA terminal loop, and recruits ZCCHC11/TUT4 uridylyltransferase, leading to the terminal uridylation of target pre-miRNAs.  Uridylated pre-miRNAs fail to be processed by Dicer and undergo degradation. This may help maintain the pluripotent state by preventing let-7-mediated differentiation of embryonic stem cells. The CSD domain is required for function in muscle differentiation while the CCHC zinc fingers interact with the GGAG motif at the 3' end of let-7 miRNAs precursors. 

Product Details

 

Gene Symbol: Lin28; CSDD1; LIN-28; ZCCHC1; Lin-28A Tex17; Gm10299; AL024421 ENSMUSG00000070700

 

NCBI Gene ID: 83557

 

Uniprot Entry: Q8K3Y3

 

Construct Details: Full length mouse Lin28 gene is subcloned into the Lentiviral expression vector pLTE with an upstream EF1α promoter and with or without a selection marker, which can be used for both transient and stable expression in mammalian cells.  It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles. Multiple selection markers are available.

 

Vector Type: pLTE or pLTE-IRES-Marker (lentiviral expression vector containing a heterologous EF1α promoter, see the vector map above)

 

Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)

 

Gene Insert Size: 630 (bp)

 

Gene Insert Sequence:  

ATGGGCTCGGTGTCCAACCAGCAGTTTGCAGGTGGCTGCGCCAAGGCAGCGGAGAAGGCGCCAGAGGAGGCGCCGCCTGA

CGCGGCCCGAGCGGCAGACGAGCCGCAGCTGCTGCACGGGGCCGGCATCTGTAAGTGGTTCAACGTGCGCATGGGGTTCG

GCTTCCTGTCTATGACCGCCCGCGCTGGGGTCGCGCTCGACCCCCCGGTGGACGTCTTTGTGCACCAGAGCAAGCTGCAC

ATGGAAGGGTTCCGAAGCCTCAAGGAGGGTGAGGCGGTGGAGTTCACCTTTAAGAAGTCTGCCAAGGGTCTGGAATCCAT

CCGTGTCACTGGCCCTGGTGGTGTGTTCTGTATTGGGAGTGAGCGGCGGCCAAAAGGGAAGAACATGCAGAAGCGAAGAT

CCAAAGGAGACAGGTGCTACAACTGCGGTGGGCTAGACCATCATGCCAAGGAATGCAAGCTGCCACCCCAGCCCAAGAAG

TGCCACTTTTGCCAAAGCATCAACCATATGGTGGCCTCGTGTCCACTGAAGGCCCAGCAGGGCCCCAGTTCTCAGGGAAA

GCCTGCCTACTTCCGGGAGGAAGAGGAAGAGATCCACAGCCCTGCCCTGCTCCCAGAAGCCCAGAATTGA

 

 

Primers: Gene insert coding sequence can be confirmed by following primers:

(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;

(b) reverse (or 3'-end) primer: 5’-CCAGGTTTCCGGGCCCTCAC-3’

 

 

Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification.  High fidelity PCR systems should always be used. 

 

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Storage

 

The product is shipped at 4°C. Upon receipt, centrifuge the product briefly before opening the vial. It is recommended to store small aliquots at the temperature below –20°C for long-term storage and the product is stable for 6 months. 

 

 

Use a manual defrost freezer and avoid repeated freeze-thaw cycles.

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

 

References

 

1. Stem Cells 22:51 (2004) 

2. J. Biol. Chem. 280:16635 (2005)

3. Mol. Cell 32:276 (2008)

4. Cell 138:696 (2009) 

5. Nat. Genet. 41:843 (2009)

6. Cell 147:1066 (2011)

 

 

 

Documentation

 

Product datasheet (pdf) can be downloaded here: LTE0029-PDS.pdf

 

 

 

Additional supporting documents, including COA and MSDS are available upon request.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Gene Synonym CSDD1; LIN28; LIN-28; ZCCHC1; Lin-28A
Gene Family Lin28 Family
Research Area Stem Cell
"A" - "Z" List
L
Pathway/Disease Induced Pluripotent Stem Cells
Species
Mouse
Molecule Class RNA-Binding Protein

Search Products

Categories
Molecule Class
Gene Family
Pathway/Disease
Research Area
CD Antigen
"A" - "Z" List
Reset All

Special Offers & Rewards

Promotion

Earn discounts, credits or rewards with your purchases.

Purchase or Clone My Genes

My Gene Clones

Get the sequence-verified, expression-ready gene clones.

Recombinant Proteins

Recombinant Proteins

Oder your high-quality, recombinant proteins of interest.

Recombinant Antibodies

Recombinant Antibodies

Try our products & services for your antibody R&D.

Virus-Based Gene Expression

Virus Gene Delivery

Acquire high titer, ready-to-use viral particles.

Get in Touch with Us

Send your question or feedback on our products & services