
T-cell surface glycoprotein CD3 zeta chain, also known as CD3z, CD247, CD3-zeta, T3z, CD3H, CD3Q, TCRZ, and IMD25, is a single-pass type I transmembrane protein of the CD3Z/FCER1G family. CD3z contains a short (9 amino acid) extracellular region and 113 amino acid cytoplasmic region with 3 ITAM (immune tyrosine activation motif) domains. CD3z is part of the T-cell receptor (TCR)/CD3 complex and is involved in T-cell development and signal transduction. The TCR/CD3 complex of T-lymphocytes consists of either a TCR alpha/beta or TCR gamma/delta heterodimer co-expressed at the cell surface with the invariant subunits of CD3 labeled gamma, delta, epsilon, zeta, and eta. CD3z plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways leading to the activation of T cells. Low expression of the antigen results in impaired immune response. CD3z forms either homodimers or heterodimers with CD3-eta. CD3z is phosphorylated on its Tyr residues after T-cell receptor triggering. CD3z interacts with many signaling molecules including SHB, ZAP70, SHC1, PTPRC, SLA, SLA2, DOCK2,TRAT1, HIV-1, and HIV-2 Nef protein. this interaction induces down-regulation of cell surface TCR/CD3 complexes. Defects in the CD3g gene are a cause of immunodeficiency 25 (IMD25), an immunological deficiency characterized by T-cells impaired immune response to alloantigens, tetanus toxoid and mitogens.
Gene Symbol: CD247; T3Z; CD3H; CD3Q; CD3Z; TCRZ; IMD25; CD3-ZETA
NCBI Gene ID: 919
Uniprot Entry: P20963
Construct Details: Full length human CD3z gene is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter and a selection marker, which can be used for both transient and stable expression in mammalian cells. It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles.
Vector Type: pLTC (lentiviral expression vector containing a heterologous CMV promoter with or without a selection marker, see the vector map above)
Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)
Gene Insert Size: 495 (bp)
Gene Insert Sequence:
ATGAAGTGGAAGGCGCTTTTCACCGCGGCCATCCTGCAGGCACAGTTGCCGATTACAGAGGCACAGAGCTTTGGCCTGCT
GGATCCCAAACTCTGCTACCTGCTGGATGGAATCCTCTTCATCTATGGTGTCATTCTCACTGCCTTGTTCCTGAGAGTGA
AGTTCAGCAGGAGCGCAGACGCCCCCGCGTACCAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAAGA
GAGGAGTACGATGTTTTGGACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGCAGAGAAGGAAGAACCCTCA
GGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGA
GGGGCAAGGGGCACGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATGCAGGCC
CTGCCCCCTCGCTAA
Primers: Gene insert coding sequence can be confirmed by following primers:
(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;
(b) Reverse (or 3'-end) primer: 5’-CGGGAAGCAATAGCATGATA-3’
Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification. High fidelity PCR systems should always be used.
FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.
Restriction: This product is not transferable or re-sellable. Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose. Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules. Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction. Your use of this product constitutes acceptance of the terms of this limited use agreement. Please refer to our “terms & conditions” for details. If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.
The product is shipped at 4°C. Upon receipt, centrifuge the product briefly before opening the vial. It is recommended to store small aliquots at the temperature below –20°C for long-term storage and the product is stable for 6 months.
Use a manual defrost freezer and avoid repeated freeze-thaw cycles.
FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.
1. Proc. Natl. Acad. Sci. 85:9709 (1988)
2. J. Virol. 72:9827 (1998)
3. Oncogene 16:891 (1998)
4. Nature 377:32 (1995)
5. J. Exp. Med. 193:1269 (2001)
6. N. Engl. J. Med. 354:1913 (2006)
Product datasheet (pdf) can be downloaded here: LTP2368-PDS.pdf
Additional supporting documents, including COA and MSDS are available upon request.
FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.
Restriction: This product is not transferable or re-sellable. Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose. Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules. Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction. Your use of this product constitutes acceptance of the terms of this limited use agreement. Please refer to our “terms & conditions” for details. If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.
Earn discounts, credits or rewards with your purchases.
Get the sequence-verified, expression-ready gene clones.
Oder your high-quality, recombinant proteins of interest.
Try our products & services for your antibody R&D.
Acquire high titer, ready-to-use viral particles.
Send your question or feedback on our products & services