Human MANF, full-length gene in lentivector, endotoxin-free DNA

Product ID: pLTC-MANF (SKU#: LTP0191)

Price:

$596.00

Description

MANF (mesencephalic astrocyte-derived neurotrophic factor), also known as ARMET (arginine-rich protein mutated in early stage tumors) and ARP (arginine-rich protein), belongs to the ARMET family. The MANF gene is located on chromosome 3p21.1, a region that is frequently deleted in a variety of solid tumors. MANF is localized in the endoplasmic reticulum (ER) and golgi, and is also secreted. MANF protects rat embryonic nigral dopaminergic neurons and restores motor function in a rat model of Parkinson’s disease (PD), a movement disorder with characteristic degeneration of dopaminergic neurons. MANF is also known to inhibit cell proliferation and ER stress-induced cell death. The crystal structure shows that MANF consists of two domains, an amino-terminal saposin-like domain that may interact with lipids or membranes and be responsible for its neurotrophic activity, and a presumably unfolded carboxy-terminal domain that may protect cells against ER stress. MANF has also been identified as one of genes in the heart that can be induced and secreted in response to ER stresses such as ischemia. Circulating MANF may protect cardiac myocytes in an antocrine and paracrine manner. MANF is also upregulated in cerebral ischemia in rats and may have neuroprotective effects against cerebral ischemia. Human MANF is 99% and 98% amino acid identical to rat and mouse MANF, respectively.

Product Details

Gene Symbol: MANF; ARP; ARMET; MGC142148; MGC142150

NCBI Gene ID: 7873

Uniprot Entry: P55145

Construct Details: Full length human MANF gene subcloned into the Lentiviral expression vector (pLTC) with a CMV promoter which can be used for both transient and stable expression in mammalian cells. It can be co-transfected with LentiPAK DNA mix (SKU# LP-001) in HEK293 cells to produce high titer lentiviral particles.

Vector Type: pLTC (lentiviral expression vector containing a heterologous CMV promoter, see the vector map above)

Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)

Gene Insert Size: 558 (bp)

Gene Insert Sequence:

ATGAGGAGGATGAGGAGGATGTGGGCCACGCAGGGGCTGGCGGTGGCGCTGGCTCTGAGCGTGCTGCCGGGCAGCCGGGC
GCTGCGGCCGGGCGACTGCGAAGTTTGTATTTCTTATCTGGGAAGATTTTACCAGGACCTCAAAGACAGAGATGTCACAT
TCTCACCAGCCACTATTGAAAACGAACTTATAAAGTTCTGCCGGGAAGCAAGAGGCAAAGAGAATCGGTTGTGCTACTAT
ATCGGGGCCACAGATGATGCAGCCACCAAAATCATCAATGAGGTATCAAAGCCTCTGGCCCACCACATCCCTGTGGAGAA
GATCTGTGAGAAGCTTAAGAAGAAGGACAGCCAGATATGTGAGCTTAAGTATGACAAGCAGATCGACCTGAGCACAGTGG
ACCTGAAGAAGCTCCGAGTTAAAGAGCTGAAGAAGATTCTGGATGACTGGGGGGAGACATGCAAAGGCTGTGCAGAAAAG
TCTGACTACATCCGGAAGATAAATGAACTGATGCCTAAATATGCCCCCAAGGCAGCCAGTGCACGGACCGATTTGTAG

Primers: Gene insert coding sequence confirmed by following primers:

(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;

(b) reverse (or 3'-end) primer: 5’-CGGGAAGCAATAGCATGATA-3’

Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification. High fidelity PCR systems should always be used.

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable. Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose. Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules. Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction. Your use of this product constitutes acceptance of the terms of this limited use agreement. Please refer to our “terms & conditions” for details. If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

Storage

The product is shipped at 4°C. Upon receipt, centrifuge the vial briefly before opening. Store at –20°C for long-term storage and the product is stable for 12 months.

Avoid repeated freeze-thaw cycles.

FOR RESEARCH USE ONLY. NOT FOR USE IN HUMAN. NOT RESELLABLE OR TRANSFERABLE

Restriction: This product is not transferable or re-sellable. Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose. Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules. Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction. Your use of this product constitutes acceptance of the terms of this limited use agreement. Please refer to our “terms & conditions” for details. If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

References