TWEAKR (TNF­related weak inducer of apoptosis receptor) s a single-pass, type I transmembrane glycoprotein in the TNF receptor superfamily (TNFRSF12).  TWEAKR was originally identified as a fibroblast growth factor­inducible immediate­early response gene termed Fn14 in mouse fibroblast cells. Human and mouse TWEAKR share 82% amino acid sequence identity.  TWEAKR is detected in almost all tissues examined. It is highly expressed in heart, placenta and kidney with intermediate expression in lung, skeletal muscle and pancreas.  TWEAKR is the smallest member of the TNFRSF and contains only one cysteine­rich region in its extracellular region that mediates the interaction with its ligand TWEAK.  TWEAKR binds TWEAK with high affinity to initiate a signal transduction cascade in cell type dependent manner.  The ligation leads to a variety of cellular responses including apoptosis, cell proliferation, and angiogenesis. The cytoplasmic domain of TWEAKR contains one TRAF binding motif which bindsTRAF1, TRAF2, and TRAF3 to initiate signal transduction. TWAEKR is a weak inducer of apoptosis in some cell types. TWEAKR promotes angiogenesis and the proliferation of endothelial cells. It may also modulate cellular adhesion to matrix proteins. Elevated levels of TWEAKR were found in hepatocellular carcinoma specimens, in regenerating mouse liver and in injured rat arteries.

TWEAKR (TNF­related weak inducer of apoptosis receptor) s a single-pass, type I transmembrane glycoprotein in the TNF receptor superfamily (TNFRSF12).  TWEAKR was originally identified as a fibroblast growth factor­inducible immediate­early response gene termed Fn14 in mouse fibroblast cells. Human and mouse TWEAKR share 82% amino acid sequence identity.  TWEAKR is detected in almost all tissues examined. It is highly expressed in heart, placenta and kidney with intermediate expression in lung, skeletal muscle and pancreas.  TWEAKR is the smallest member of the TNFRSF and contains only one cysteine­rich region in its extracellular region that mediates the interaction with its ligand TWEAK.  TWEAKR binds TWEAK with high affinity to initiate a signal transduction cascade in cell type dependent manner.  The ligation leads to a variety of cellular responses including apoptosis, cell proliferation, and angiogenesis. The cytoplasmic domain of TWEAKR contains one TRAF binding motif which bindsTRAF1, TRAF2, and TRAF3 to initiate signal transduction. TWAEKR is a weak inducer of apoptosis in some cell types. TWEAKR promotes angiogenesis and the proliferation of endothelial cells. It may also modulate cellular adhesion to matrix proteins. Elevated levels of TWEAKR were found in hepatocellular carcinoma specimens, in regenerating mouse liver and in injured rat arteries.

  

Product Details

 

Gene Symbol: TWEAKR; TNFRSF12A; CD266; FN14; TWEAK-R

 

NCBI Gene ID: 51330

 

Uniprot Entry: Q9NP84

 

Construct Details: Full length human TWEAKR/CD266 gene is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter, which can be used for both transient and stable expression in mammalian cells.  It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles.

 

Vector Type: pLTC (lentiviral expression vector containing a heterologous CMV promoter, see the vector map above)

 

Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)

 

Gene Insert Sequence:  

ATGGCTCGGGGCTCGCTGCGCCGGTTGCTGCGGCTCCTCGTGCTGGGGCTCTGGCTGGCGTTGCTGCGCTCCGTGGCCGG

GGAGCAAGCGCCAGGCACCGCCCCCTGCTCCCGCGGCAGCTCCTGGAGCGCGGACCTGGACAAGTGCATGGACTGCGCGT

CTTGCAGGGCGCGACCGCACAGCGACTTCTGCCTGGGCTGCGCTGCAGCACCTCCTGCCCCCTTCCGGCTGCTTTGGCCC

ATCCTTGGGGGCGCTCTGAGCCTGACCTTCGTGCTGGGGCTGCTTTCTGGCTTTTTGGTCTGGAGACGATGCCGCAGGAG

AGAGAAGTTCACCACCCCCATAGAGGAGACCGGCGGAGAGGGCTGCCCAGCTGTGGCGCTGATCCAGTGA

 

Primers: Gene insert coding sequence can be confirmed by following primers:

(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;

(b) reverse (or 3'-end) primer: 5’-CGGGAAGCAATAGCATGATA-3’

 

 

Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification.  High fidelity PCR systems should always be used. 

 

  

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Storage

 

The product is shipped at 4°C. Upon receipt, centrifuge the product briefly before opening the vial. It is recommended to store small aliquots at the temperature below –20°C for long-term storage and the product is stable for 6 months. 

 

 

 

Use a manual defrost freezer and avoid repeated freeze-thaw cycles.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

 

References

 

1. J. Biol. Chem. 274:8455 (1999). 

2. J. Biol. Chem. 274:33166 (1999).

3. Am J. Pathol. 156:1253 (2000). 

4. Immunity 15:837 (2001). 

5. J. Immunol. 168:734 (2002). 

6. Protein Sci. 18:650 (2009). 

 

 

 

 

Documentation

 

Product datasheet (pdf) can be downloaded here: LTP0082-PDS.pdf

 

 

 

Additional supporting documents, including COA and MSDS are available upon request.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.