KRAS is a Kirsten RAS oncogene homolog from the mammalian RAS gene family related to the transforming genes of mammalian sarcoma retroviruses.  The RAS family members have intrinsic GTPase activity and serve as molecular switch to relay extracellular stimuli to a variety of downstream effectors.  Normally RAS cycles between an inactive GDP-bound state, a transient nucleotide-free state, and the active GTP-bound state that engages effectors to initiate various signaling pathways to promote cell growth and survival.  Humans have 3 RAS genes: HRAS, NRAS, and KRAS, encoding 4 highly homologous ~21 kDa proteins: HRAS, NRAS, KRAS4A and KRAS4B (the major isoform of KRAS).  RAS is the most frequently mutated oncogene, present in ~30% of all cancers and KRAS accounts for ~83% of RAS mutations in cancers.  Most of these mutations shift RAS to favor the GTP-bound state, resulting in constitutive activation of downstream effector pathways. Mutations which change the amino acid 12, 13 or 61 of KRAS activate it to transform cultured cells and are implicated in many cancers. KRAS is mutated in nearly 100% of pancreatic ductal adenocarcinoma (PDAC), with frequent mutational activation in lung (30%) and colorectal cancers (45%), making it a target of interest for developing anti-cancer agents. 

KRAS is a Kirsten RAS oncogene homolog from the mammalian RAS gene family related to the transforming genes of mammalian sarcoma retroviruses.  The RAS family members have intrinsic GTPase activity and serve as molecular switch to relay extracellular stimuli to a variety of downstream effectors.  Normally RAS cycles between an inactive GDP-bound state, a transient nucleotide-free state, and the active GTP-bound state that engages effectors to initiate various signaling pathways to promote cell growth and survival.  Humans have 3 RAS genes: HRAS, NRAS, and KRAS, encoding 4 highly homologous ~21 kDa proteins: HRAS, NRAS, KRAS4A and KRAS4B (the major isoform of KRAS).  RAS is the most frequently mutated oncogene, present in ~30% of all cancers and KRAS accounts for ~83% of RAS mutations in cancers.  Most of these mutations shift RAS to favor the GTP-bound state, resulting in constitutive activation of downstream effector pathways. Mutations which change the amino acid 12, 13 or 61 of KRAS activate it to transform cultured cells and are implicated in many cancers. KRAS is mutated in nearly 100% of pancreatic ductal adenocarcinoma (PDAC), with frequent mutational activation in lung (30%) and colorectal cancers (45%), making it a target of interest for developing anti-cancer agents. 

 

Product Details

 

Gene Symbol: KRAS; KRAS4B; NS; NS3; OES; CFC2; RALD; K-Ras; KRAS1; KRAS2; RASK2; KI-RAS; C-K-RAS; K-RAS2A; K-RAS2B; K-RAS4A; K-RAS4B; K-Ras 2; 'C-K-RAS; c-Ki-ras; c-Ki-ras2

 

NCBI Gene ID: 3845

 

Uniprot Entry: P01116

 

Construct Details: Full length human KRAS gene (encoding KRAS4B UniProt #P01116-2) is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter and with or without a selection marker, which can be used for both transient and stable expression in mammalian cells.  It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles. Multiple choices of a stable antibiotic selection marker are available.

 

Vector Type: pLTC or pLTC-IRES-Marker (lentiviral expression vector containing a heterologous CMV promoter, see the vector map above)

 

Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)

 

Gene Insert Size: 567 (bp)

 

Gene Insert Sequence:  

ATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGCCTTGACGATACAGCTAA

TTCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAGGATTCCTACAGGAAGCAAGTAGTAATTGA

TGGAGAAACCTGTCTCTTGGATATTCTCGACACAGCAGGTCAAGAGGAGTACAGTGCAATGAGGGACCAG

TACATGAGGACTGGGGAGGGCTTTCTTTGTGTATTTGCCATAAATAATACTAAATCATTTGAAGATATTC

ACCATTATAGAGAACAAATTAAAAGAGTTAAGGACTCTGAAGATGTACCTATGGTCCTAGTAGGAAATAA

ATGTGATTTGCCTTCTAGAACAGTAGACACAAAACAGGCTCAGGACTTAGCAAGAAGTTATGGAATTCCT

TTTATTGAAACATCAGCAAAGACAAGACAGGGTGTTGATGATGCCTTCTATACATTAGTTCGAGAAATTC

GAAAACATAAAGAAAAGATGAGCAAAGATGGTAAAAAGAAGAAAAAGAAGTCAAAGACAAAGTGTGTAAT

TATGTAA

 

 

Primers: Gene insert coding sequence can be confirmed by following primers:

(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;

(b) reverse (or 3'-end) primer: 5’-CCAGGTTTCCGGGCCCTCAC-3’

 

 

Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification.  High fidelity PCR systems should always be used. 

 

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Storage

 

The product is shipped at 4°C. Upon receipt, centrifuge the product briefly before opening the vial. It is recommended to store small aliquots at the temperature below –20°C for long-term storage and the product is stable for 6 months. 

 

 

Use a manual defrost freezer and avoid repeated freeze-thaw cycles.

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

 

 

 

Documentation

 

 

Additional supporting documents, including PDS, COA and MSDS are available upon request.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.