Smaller Font Default Font Larger Font

You are here:

PrintEmail

Human IFITM3/DSPA2b Gene, Full-length cDNA in Lentivector, Endotoxin-free DNA

Product ID: pLTC-IFITM3 (SKU#: LTP1223 )

For Bulk Order: Call for price

Price:
$696.00
Size

Selection Marker

Description

IFITM3 (interferon-induced transmembrane protein 3) also known as DSPA2b (dispanin subfamily A member 2b) is a single-pass transmembrane protein belonging to the CD225/Dispanin family. IFTIM2 is an interferon-induced antiviral protein which disrupts intracellular cholesterol homeostasis and inhibits the entry of viruses to the host cell cytoplasm by preventing viral fusion with cholesterol depleted endosomes. IFITM3 may inactivate new enveloped viruses which buds out of the infected cell, by letting them go out with a cholesterol depleted membrane. It is active against multiple viruses, including influenza A virus, SARS coronavirus (SARS-CoV), Marburg virus (MARV) and Ebola virus (EBOV), Dengue virus (DNV), West Nile virus (WNV), human immunodeficiency virus type 1 (HIV-1) and vesicular stomatitis virus (VSV). It can inhibit: influenza virus hemagglutinin protein-mediated viral entry, MARV and EBOV GP1,2-mediated viral entry, SARS-CoV S protein-mediated viral entry and VSV G protein-mediated viral entry. IFITM3 plays a critical role in the structural stability and function of vacuolar ATPase (v-ATPase) and establishes physical contact with the v-ATPase of endosomes which is critical for proper clathrin localization and for the function of the v-ATPase to lower the pH in phagocytic endosomes thus establishing an antiviral state.

 

IFITM3 (interferon-induced transmembrane protein 3) also known as DSPA2b (dispanin subfamily A member 2b) is a single-pass transmembrane protein belonging to the CD225/Dispanin family. IFTIM2 is an interferon-induced antiviral protein which disrupts intracellular cholesterol homeostasis and inhibits the entry of viruses to the host cell cytoplasm by preventing viral fusion with cholesterol depleted endosomes. IFITM3 may inactivate new enveloped viruses which buds out of the infected cell, by letting them go out with a cholesterol depleted membrane. It is active against multiple viruses, including influenza A virus, SARS coronavirus (SARS-CoV), Marburg virus (MARV) and Ebola virus (EBOV), Dengue virus (DNV), West Nile virus (WNV), human immunodeficiency virus type 1 (HIV-1) and vesicular stomatitis virus (VSV). It can inhibit: influenza virus hemagglutinin protein-mediated viral entry, MARV and EBOV GP1,2-mediated viral entry, SARS-CoV S protein-mediated viral entry and VSV G protein-mediated viral entry. IFITM3 plays a critical role in the structural stability and function of vacuolar ATPase (v-ATPase) and establishes physical contact with the v-ATPase of endosomes which is critical for proper clathrin localization and for the function of the v-ATPase to lower the pH in phagocytic endosomes thus establishing an antiviral state.

 

Product Details

 

Gene Symbol: IFITM3; 1-8U; IP15; DSPA2b

 

NCBI Gene ID: 10410

 

Uniprot Entry: Q01628

 

Construct Details: Full length human IFITM3 gene is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter and with or without an antibiotic selection marker, which can be used for both transient and stable expression in mammalian cells.  It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles. Multiple choices of a stable antibiotic selection marker are available.

 

Vector Type: pLTC or pLTC-IRES-Marker (lentiviral expression vector containing a heterologous CMV promoter +/- a selection marker, see the vector map above)

 

Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)

 

Gene Insert Size: 402 (bp)

 

Gene Insert Sequence:  

ATGAATCACACTGTCCAAACCTTCTTCTCTCCTGTCAACAGTGGCCAGCCCCCCAACTATGAGATGCTCA

AGGAGGAGCACGAGGTGGCTGTGCTGGGGGCGCCCCACAACCCTGCTCCCCCGACGTCCACCGTGATCCA

CATCCGCAGCGAGACCTCCGTGCCCGACCATGTCGTCTGGTCCCTGTTCAACACCCTCTTCATGAACCCC

TGCTGCCTGGGCTTCATAGCATTCGCCTACTCCGTGAAGTCTAGGGACAGGAAGATGGTTGGCGACGTGA

CCGGGGCCCAGGCCTATGCCTCCACCGCCAAGTGCCTGAACATCTGGGCCCTGATTCTGGGCATCCTCAT

GACCATTCTGCTCATCGTCATCCCAGTGCTGATCTTCCAGGCCTATGGATAG

 

Primers: Gene insert coding sequence can be confirmed by following primers:

(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;

(b) reverse (or 3'-end) primer: 5’-CCAGGTTTCCGGGCCCTCAC-3’

 

 

Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification.  High fidelity PCR systems should always be used. 

 

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Storage

 

The product is shipped at 4°C. Upon receipt, centrifuge the product briefly before opening the vial. It is recommended to store small aliquots at the temperature below –20°C for long-term storage and the product is stable for 6 months. 

 

 

Use a manual defrost freezer and avoid repeated freeze-thaw cycles.

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

 

References

 

 

 

Additional supporting documents, including PDS, COA and MSDS are available upon request.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Gene Synonym IFITM3; 1-8U; IP15; DSPA2b
Gene Family CD225/Dispanin Family
Research Area Immunology
"A" - "Z" List
I
Pathway/Disease Interferon Signaling
Species
Human
Molecule Class 1-Pass Transmembrane

Search Products

Categories
Molecule Class
Gene Family
Pathway/Disease
Research Area
CD Antigen
"A" - "Z" List
Reset All

Special Offers & Rewards

Promotion

Earn discounts, credits or rewards with your purchases.

Purchase or Clone My Genes

My Gene Clones

Get the sequence-verified, expression-ready gene clones.

Recombinant Proteins

Recombinant Proteins

Oder your high-quality, recombinant proteins of interest.

Recombinant Antibodies

Recombinant Antibodies

Try our products & services for your antibody R&D.

Virus-Based Gene Expression

Virus Gene Delivery

Acquire high titer, ready-to-use viral particles.

Get in Touch with Us

Send your question or feedback on our products & services