LAIR1 (leukocyte-associated immunoglobulin-like receptor 1) or CD305 is a 287 amino acid (aa) single pass type I transmembrane glycoprotein that belongs to the LAIR family of the Immunoglobulin superfamily (IgSF). The LAIR1 gene maps to a region of 19q13.4 called the leukocyte receptor cluster with at least 29 genes encoding leukocyte-expressed receptors of the IgSF. LAIR1 contains an N-terminal signal peptide, a 144-aa extracellular domain (ECD) with 1 Ig-like C2-type domain and 1 potential N-linked glycosylation site, a transmembrane domain (TM), and a 101-aa cytoplasmic tail with 2 ITIM (immunoreceptor tyrosine-based inhibitor motif) motifs. When phosphorylated, ITIM motif can bind the SH2 domain of SH2-containing phosphatases such as PTPN6 and PTPN11, leading to down-regulation of cell activation.  LAIR1 acts as an inhibitory receptor found on peripheral mononuclear cells, including natural killer cells, T cells, and B cells.  LAIR1 regulate the immune response to prevent lysis of cells recognized as self. LAIR1 was also identified as an anchor for tyrosine phosphatase SHP-1, and may induce cell death in myeloid leukemias. LAIR1 modulates cytokine production in CD4+ T-cells, down-regulating IL2 and IFNG production while inducing secretion of transforming growth factor beta (TGFbeta). It also down-regulates also IgG and IgE production in B-cells as well as IL8, IL10 and TNF secretion. LAIR1 inhibits the differentiation of peripheral blood precursors towards dendritic cells

LAIR1 (leukocyte-associated immunoglobulin-like receptor 1) or CD305 is a 287 amino acid (aa) single pass type I transmembrane glycoprotein that belongs to the LAIR family of the Immunoglobulin superfamily (IgSF). The LAIR1 gene maps to a region of 19q13.4 called the leukocyte receptor cluster with at least 29 genes encoding leukocyte-expressed receptors of the IgSF. LAIR1 contains an N-terminal signal peptide, a 144-aa extracellular domain (ECD) with 1 Ig-like C2-type domain and 1 potential N-linked glycosylation site, a transmembrane domain (TM), and a 101-aa cytoplasmic tail with 2 ITIM (immunoreceptor tyrosine-based inhibitor motif) motifs. When phosphorylated, ITIM motif can bind the SH2 domain of SH2-containing phosphatases such as PTPN6 and PTPN11, leading to down-regulation of cell activation.  LAIR1 acts as an inhibitory receptor found on peripheral mononuclear cells, including natural killer cells, T cells, and B cells.  LAIR1 regulate the immune response to prevent lysis of cells recognized as self. LAIR1 was also identified as an anchor for tyrosine phosphatase SHP-1, and may induce cell death in myeloid leukemias. LAIR1 modulates cytokine production in CD4+ T-cells, down-regulating IL2 and IFNG production while inducing secretion of transforming growth factor beta (TGFbeta). It also down-regulates also IgG and IgE production in B-cells as well as IL8, IL10 and TNF secretion. LAIR1 inhibits the differentiation of peripheral blood precursors towards dendritic cells

 

Product Details

 

Gene Symbol: LAIR1; CD305; LAIR-1

 

NCBI Gene ID: 3903

 

Uniprot Entry: Q6GTX8

 

Construct Details: Full length human LAIR1/CD305 gene is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter and with or without an antibiotic selection marker, which can be used for both transient and stable expression in mammalian cells.  It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles. Multiple choices of a stable antibiotic selection marker are available.

 

Vector Type: pLTC or pLTC-IRES-Marker (lentiviral expression vector containing a heterologous CMV promoter +/- a selection marker, see the vector map above)

 

Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)

 

Gene Insert Size: 864 (bp)

 

Gene Insert Sequence:  

ATGTCTCCCCACCCCACCGCCCTCCTGGGCCTAGTGCTCTGCCTGGCCCAGACCATCCACACGCAGGAGGAAGATCTGCC

CAGACCCTCCATCTCGGCTGAGCCAGGCACCGTGATCCCCCTGGGGAGCCATGTGACTTTCGTGTGCCGGGGCCCGGTTG

GGGTTCAAACATTCCGCCTGGAGAGGGAGAGTAGATCCACATACAATGATACTGAAGATGTGTCTCAAGCTAGTCCATCT

GAGTCAGAGGCCAGATTCCGCATTGACTCAGTAAGTGAAGGAAATGCCGGGCCTTATCGCTGCATCTATTATAAGCCCCC

TAAATGGTCTGAGCAGAGTGACTACCTGGAGCTGCTGGTGAAAGAAACCTCTGGAGGCCCGGACTCCCCGGACACAGAGC

CCGGCTCCTCAGCTGGACCCACGCAGAGGCCGTCGGACAACAGTCACAATGAGCATGCACCTGCTTCCCAAGGCCTGAAA

GCTGAGCATCTGTATATTCTCATCGGGGTCTCAGTGGTCTTCCTCTTCTGTCTCCTCCTCCTGGTCCTCTTCTGCCTCCA

TCGCCAGAATCAGATAAAGCAGGGGCCCCCCAGAAGCAAGGACGAGGAGCAGAAGCCACAGCAGAGGCCTGACCTGGCTG

TTGATGTTCTAGAGAGGACAGCAGACAAGGCCACAGTCAATGGACTTCCTGAGAAGGACAGAGAGACGGACACCTCGGCC

CTGGCTGCAGGGAGTTCCCAGGAGGTGACGTATGCTCAGCTGGACCACTGGGCCCTCACACAGAGGACAGCCCGGGCTGT

GTCCCCACAGTCCACAAAGCCCATGGCCGAGTCCATCACGTATGCAGCCGTTGCCAGACACTAG

 

 

Primers: Gene insert coding sequence can be confirmed by following primers:

(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;

(b) reverse (or 3'-end) primer: 5’-CCAGGTTTCCGGGCCCTCAC-3’

 

 

Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification.  High fidelity PCR systems should always be used. 

 

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Storage

 

The product is shipped at 4°C. Upon receipt, centrifuge the product briefly before opening the vial. It is recommended to store small aliquots at the temperature below –20°C for long-term storage and the product is stable for 6 months. 

 

 

Use a manual defrost freezer and avoid repeated freeze-thaw cycles.

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

 

References

 

 

 

Additional supporting documents, including PDS, COA and MSDS are available upon request.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.