CAMPATH-1 antigen, also known as CD52, is a peptide of 12 amino acids, anchored to glycosylphosphatidylinositol (GPI). CD52 is present on the surface of mature lymphocytes, but not on the stem cells from which these lymphocytes were derived. CD52 also is found on monocytes and dendritic cells as well as within the male genital tract and is present on the surface of mature sperm cells.  Since it is highly negatively charged and present on sperm cells and lymphocytes, it has been conjectured that its function is anti-adhesion, allowing cells to freely move around. CD52 binds the ITIM (Immunoreceptor tyrosine-based inhibitory motif)-bearing sialic acid-binding lectin SIGLEC10.  CD52 may also play a role in carrying and orienting carbohydrate. CD52 is the antigen targeted by alemtuzumab, a monoclonal antibody used for the treatment of chronic lymphocytic leukemia (CLL).

CAMPATH-1 antigen, also known as CD52, is a peptide of 12 amino acids, anchored to glycosylphosphatidylinositol (GPI). CD52 is present on the surface of mature lymphocytes, but not on the stem cells from which these lymphocytes were derived. CD52 also is found on monocytes and dendritic cells as well as within the male genital tract and is present on the surface of mature sperm cells.  Since it is highly negatively charged and present on sperm cells and lymphocytes, it has been conjectured that its function is anti-adhesion, allowing cells to freely move around. CD52 binds the ITIM (Immunoreceptor tyrosine-based inhibitory motif)-bearing sialic acid-binding lectin SIGLEC10.  CD52 may also play a role in carrying and orienting carbohydrate. CD52 is the antigen targeted by alemtuzumab, a monoclonal antibody used for the treatment of chronic lymphocytic leukemia (CLL).

 

Product Details

 

Gene Symbol: CD52; CDW52; He5; CAMPATH-1

 

NCBI Gene ID: 1043

 

Uniprot Entry: P31358

 

Construct Details: Full length human CD52 gene is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter and with or without a selection marker, which can be used for both transient and stable expression in mammalian cells.  It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles. Multiple choices of a stable antibiotic selection marker are available.

 

Vector Type: pLTC or pLTC-IRES-Marker (lentiviral expression vector containing a heterologous CMV promoter +/- a selection marker, see the vector map above)

 

Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)

 

Gene Insert Size: 186 (bp)

 

Gene Insert Sequence:  

ATGAAGCGCTTCCTCTTCCTCCTACTCACCATCAGCCTCCTGGTTATGGTACAGATACAAACTGGACTCT

CAGGACAAAACGACACCAGCCAAACCAGCAGCCCCTCAGCATCCAGCAACATAAGCGGAGGCATTTTCCT

TTTCTTCGTGGCCAATGCCATAATCCACCTCTTCTGCTTCAGTTGA

 

 

Primers: Gene insert coding sequence can be confirmed by following primers:

(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;

(b) reverse (or 3'-end) primer: 5’-CCAGGTTTCCGGGCCCTCAC-3’

 

 

Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification.  High fidelity PCR systems should always be used. 

 

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Storage

 

The product is shipped at 4°C. Upon receipt, centrifuge the product briefly before opening the vial. It is recommended to store small aliquots at the temperature below –20°C for long-term storage and the product is stable for 6 months. 

 

 

Use a manual defrost freezer and avoid repeated freeze-thaw cycles.

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

 

References

 

1. Eur. J. Immunol. 21:1677 (1991) 

2. Mol. Reprod. Dev. 34:8 (1993)

3. Biochem. J. 293:633 (1993)

4. Methods Mol. Med. 40: 243 (2000)

5. Blood 100 (5): 1715 (2002)

 

 

 

 

Additional supporting documents, including datasheet, COA and MSDS are available upon request.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.