
CD317, also known as BST-2 (bone marrow stromal antigen 2) and Tetherin, is a single pass type Ⅱ transmembrane protein with a unique topology. CD317 consists of an N-terminal cytoplasmic tail, followed by a transmembrane domain, an extracellular domain or loop, and a C-terminal GPI-linkage. The extracellular loop contains a coiled coil domain that forms a long semi-flexible rod-like structure, which may be important for virion retention at the cell surface and prevention of virus spreading. In addition the GPI anchor is essential for its antiviral activity. CD317 is expressed predominantly in liver, lung, heart and placenta. It is also expressed on bone marrow stromal cells and is upregulated in breast cancer, astrocytoma, and multiple myeloma cells. CD317 is highly expressed during B-cell development, from pro-B precursors to plasma cells, and on T-cells, monocytes, NK cells and dendritic cells. CD317 is involved in B-cell development and growth. CD317 is an interferon (IFN)-induced antiviral host restriction factor that efficiently blocks the release of diverse mammalian enveloped viruses by directly tethering nascent virions to the membranes of infected cells. CD317 is active against at least 4 virus families: retroviruses, filoviruses, arenaviruses, and herpesviruses. CD317 can act as an inhibitor to HIV-1 infection in the absence of Vpu and inhibit the release of other viruses such as the Lassa, Marburg virions, and Kaposi sarcoma virus. CD317 binds to ILT7 on plasmacytoid dendritic cells and may provide negative feedback to the production of IFN by plasmacytoid dendritic cells in response to viral infection.
Gene Symbol: CD317; BST2; BST-2; Tetherin
NCBI Gene ID: 684
Uniprot Entry: Q10589
Construct Details: Full length human BST2/CD317 gene (encoding UniProt #Q10589) is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter and with or without a selection marker, which can be used for both transient and stable expression in mammalian cells. It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles. Multiple choices of a stable antibiotic selection marker are available.
Vector Type: pLTC or pLTC-IRES-Marker (lentiviral expression vector containing a heterologous CMV promoter +/- a selection marker, see the vector map above)
Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)
Gene Insert Size: 543 (bp)
Gene Insert Sequence:
ATGGCATCTACTTCGTATGACTATTGCAGAGTGCCCATGGAAGACGGGGATAAGCGCTGTAAGCTTCTGC
TGGGGATAGGAATTCTGGTGCTCCTGATCATCGTGATTCTGGGGGTGCCCTTGATTATCTTCACCATCAA
GGCCAACAGCGAGGCCTGCCGGGACGGCCTTCGGGCAGTGATGGAGTGTCGCAATGTCACCCATCTCCTG
CAACAAGAGCTGACCGAGGCCCAGAAGGGCTTTCAGGATGTGGAGGCCCAGGCCGCCACCTGCAACCACA
CTGTGATGGCCCTAATGGCTTCCCTGGATGCAGAGAAGGCCCAAGGACAAAAGAAAGTGGAGGAGCTTGA
GGGAGAGATCACTACATTAAACCATAAGCTTCAGGACGCGTCTGCAGAGGTGGAGCGACTGAGAAGAGAA
AACCAGGTCTTAAGCGTGAGAATCGCGGACAAGAAGTACTACCCCAGCTCCCAGGACTCCAGCTCCGCTG
CGGCGCCCCAGCTGCTGATTGTGCTGCTGGGCCTCAGCGCTCTGCTGCAGTGA
Primers: Gene insert coding sequence can be confirmed by following primers:
(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;
(b) reverse (or 3'-end) primer: 5’-CCAGGTTTCCGGGCCCTCAC-3’
Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification. High fidelity PCR systems should always be used.
FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.
Restriction: This product is not transferable or re-sellable. Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose. Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules. Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction. Your use of this product constitutes acceptance of the terms of this limited use agreement. Please refer to our “terms & conditions” for details. If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.
The product is shipped at 4°C. Upon receipt, centrifuge the product briefly before opening the vial. It is recommended to store small aliquots at the temperature below –20°C for long-term storage and the product is stable for 6 months.
Use a manual defrost freezer and avoid repeated freeze-thaw cycles.
FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.
1. Genomics 26:527-534(1995)
2. Cell. Immunol. 236:6-16(2005)
3. Nature 451:425-430(2008)
4. Cell 139:499-511(2009)
5. J. Exp. Med. 206:1603-1614(2009)
Product datasheet (pdf) can be downloaded here: LTP2538-PDS.pdf
Additional supporting documents, including COA and MSDS are available upon request.
FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.
Restriction: This product is not transferable or re-sellable. Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose. Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules. Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction. Your use of this product constitutes acceptance of the terms of this limited use agreement. Please refer to our “terms & conditions” for details. If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.
Earn discounts, credits or rewards with your purchases.
Get the sequence-verified, expression-ready gene clones.
Oder your high-quality, recombinant proteins of interest.
Try our products & services for your antibody R&D.
Acquire high titer, ready-to-use viral particles.
Send your question or feedback on our products & services