Human CD64/CD64A/FCGR1A/FCGR1 Lentivirus, Full-length Gene in Lentivector, Pre-packaged Lentiviral Particles

Description

There are 3 classes of receptors for the Fc region of IgG (FcγRs): FcγRI (CD64), FcγRII (CD32), and FcγRIII (CD16), each with multiple isoforms.  All these receptors are members of the Ig superfamily (IgSF) and they play important roles in the activation or inhibition of immune responses. FcγRI (CD64) is a high-affinity receptor for IgG while both FcγRII and FcγRIII are low-affinity receptors that bind IgG in the form of immune complexes. CD64 is single pass transmembrane protein with 3 extracellular Ig-like C2 type motifs. CD64 is expressed constitutively on monocytes and macrophages and can be induced on neutrophils and eosinophils.  Its expression is up-regulated during bacterial infections and sepsis. CD64 functions in both innate and adaptive immune responses.  The high affinity recognition of IgG by Fc gamma  RI permits the triggering of effector responses at low IgG concentrations typical of early immune responses. Three highly homologous genes (A, B, and C) with 98% DNA sequence identity have been identified for the human CD64 group. The genes for isoform B and C contain stop codons within their membrane proximal Ig-like motifs generating possible secreted receptors.  A splice variant of CD64 has a deletion of the membrane-proximal Ig-like domain resulting in a putative transmembrane receptor.

 

 

Gene Symbol: CD64; FCGR1A; FCRI; CD64A; FCG1; FCGR1; IGFR1; FCGRI

 

NCBI Gene ID: 2209

 

Uniprot Entry: P12314

 

Construct Details: Full length human CD64/FCGR1 gene (encoding UniProt #P12314) is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter and with or without a selection marker, which can be used for both transient and stable expression in mammalian cells.  It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles. Multiple choices of a stable antibiotic selection marker are available.

 

Vector Type: pLTC or pLTC-IRES-Marker (lentiviral expression vector containing a heterologous CMV promoter +/- a selection marker, see the vector map above)

 

Gene Insert Sequence:  

ATGTGGTTCTTGACAACTCTGCTCCTTTGGGTTCCAGTTGATGGGCAAGTGGACACCACAAAGGCAGTGA

TCACTTTGCAGCCTCCATGGGTCAGCGTGTTCCAAGAGGAAACCGTAACCTTGCACTGTGAGGTGCTCCA

TCTGCCTGGGAGCAGCTCTACACAGTGGTTTCTCAATGGCACAGCCACTCAGACCTCGACCCCCAGCTAC

AGAATCACCTCTGCCAGTGTCAATGACAGTGGTGAATACAGGTGCCAGAGAGGTCTCTCAGGGCGAAGTG

ACCCCATACAGCTGGAAATCCACAGAGGCTGGCTACTACTGCAGGTCTCCAGCAGAGTCTTCACGGAAGG

AGAACCTCTGGCCTTGAGGTGTCATGCGTGGAAGGATAAGCTGGTGTACAATGTGCTTTACTATCGAAAT

GGCAAAGCCTTTAAGTTTTTCCACTGGAATTCTAACCTCACCATTCTGAAAACCAACATAAGTCACAATG

GCACCTACCATTGCTCAGGCATGGGAAAGCATCGCTACACATCAGCAGGAATATCTGTCACTGTGAAAGA

GCTATTTCCAGCTCCAGTGCTGAATGCATCTGTGACATCCCCACTCCTGGAGGGGAATCTGGTCACCCTG

AGCTGTGAAACAAAGTTGCTCTTGCAGAGGCCTGGTTTGCAGCTTTACTTCTCCTTCTACATGGGCAGCA

AGACCCTGCGAGGCAGGAACACATCCTCTGAATACCAAATACTAACTGCTAGAAGAGAAGACTCTGGGTT

ATACTGGTGCGAGGCTGCCACAGAGGATGGAAATGTCCTTAAGCGCAGCCCTGAGTTGGAGCTTCAAGTG

CTTGGCCTCCAGTTACCAACTCCTGTCTGGTTTCATGTCCTTTTCTATCTGGCAGTGGGAATAATGTTTT

TAGTGAACACTGTTCTCTGGGTGACAATACGTAAAGAACTGAAAAGAAAGAAAAAGTGGGATTTAGAAAT

CTCTTTGGATTCTGGTCATGAGAAGAAGGTAATTTCCAGCCTTCAAGAAGACAGACATTTAGAAGAAGAG

CTGAAATGTCAGGAACAAAAAGAAGAACAGCTGCAGGAAGGGGTGCACCGGAAGGAGCCCCAGGGGGCCA

CGTAG

 

Formulation: Lentivector encoded and pre-packaged viral particles (typical titer 10⁶ - 10⁷ IFU/ml) in the conditional medium (serum-free) from HEK293 cells that have been transfected with the lentivector gene clone and the LentiPAK DNA mix

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Important Safety Information: With the safety features in place, our lentiviral vectors and viral particles can be employed in standard Biosafety Level 2 tissue culture facilities and should be treated with the same level of caution as any other potentially infectious agent. Any investigator who purchases our lentiviral/retroviral products & services is responsible for following Biosafety Level 2 requirements on the handling of viral particles. For more information on Biosafety Level 2 agents and practices, please refer to NIH’s “Biosafety Considerations for Research with Lentiviral Vectors”.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

 

Pre-packaged lentiviral particles are most advanced gene delivery tools. Each particles contain a fully sequence verified target gene and are psudotyped with the VSV-G glycoprotein, ready for transduction into into a wide range of cell types including hard-to-transfect primary cells and non-dividing cells. They are supplied in 1-mL aliquot(s) of the serum-/antibiotic-free solution suitable for both in vitro and in vivo delivery. They are produced in HEK293 packaging cells with a typical titer of ≥10⁷ IFU/ml using our optimized LentPAK^TM packaging system. The lentiviral particles can be used to transduce subconfluent target cells. Depending on your purpose, you may choose a specific multiplicity of infection (MOI) or test a range of MOIs to determine which gives you the desired results. Transduction can be enhanced by the addition of polybrene, also known as hexadimethrine bromide (typically at 8-10 μg/ml). 

 

Quick Protocol for Transduction

 

Day 1. Seeding Target Cells

For an example, plate target cells in a 10 cm plate at a density of 1 - 5x 10⁵ cells/ml that will produce approximately 60% confluency in 24 hours.

 

Note: other size plates can also be used depending on the nature of your experiment. Adjust the reagent amount according to Table 1

 

Table 1. Seeding Density of Target Cells (1 day prior to transduction)

Vessel Type	Seeding Density	Volume of Media
10-cm dish	1 – 5 x 106	10 mL
6-well plate	0.3 – 1 x 106	2 mL/well
12-well plate	0.15 – 0.5 x 106	1 mL/well
24-well plate	0.6 – 2 x 105	0.5 mL/well
96-well plate	1 – 4 x 104	0.1 mL/well

  

Day 2. Transduction

Remove the growth media from the dish/plate prepared the day before. Replace with 1/2 volume of culture medium containing desired amount of lentiviral particles (at 2 to 20 MOI).  For example, add 4.5 mL of growth medium and 0.5 mL of Lentiviral particles, or simply add 5 mL of Lentiviral particles (for a low titer viral preparation or a high MOI transduction). Add polybrene directly to the media on the target cells at 8 μg/ml. Mix by gentle swirling.

 

Incubate at 37°C with 5% CO2 for 4 - 24 hours, then replace the transduction medium with right amount of growth medium according to table 1 (for example 10 mL for 10-cm dish). Culture the cells for 48 – 72 hours, and transduced cells are ready for downstream analyses.

 

Note: Adjust volumes accordingly for transduction of other plate types.  For example, add 1 ml of growth medium and lentiviral particle mixture for 6-well plate, 0.5 ml for 12-well and 0.25 mL for 24-well except for 96 well, in which 100 μl should be used. The change of transduction medium is often unnecessary with our pre-packaged lentiviral particles.  Simply culture cells for 3-4 days before analysis. 

 

The virus-containing media can be changed in as short as 4 hours after transduction if toxicity of the lentiviral transduction is a concern. Normally reverse transcription and genome integration of the lentivector takes place within 24-36 hours. With our ready-to-use, prepackaged lentiviral particles, the change of media is often unnecessary. The transduction process can be ongoing for 2 - 6 days without significant impact on cell growth/viability. The transduction process can also be repeated if desired. For a lentivector with a fluorescent reporter (such as GFP), FACS can be used to enrich for cells that express GFP. If it contains a drug selectable marker, follow the protocol for the particular drug. For example, puromycin selection is usually carried out at 1-10 μg/mL, depending on the target cells’ sensitivity

 

 

Important Safety Information

With the safety features in place, our lentiviral vectors and viral particles can be employed in standard Biosafety Level 2 tissue culture facilities and should be treated with the same level of caution as any other potentially infectious agent. Any investigator who purchases our lentiviral/retroviral products & services is responsible for following Biosafety Level 2 requirements on the handling of viral particles. For more information on Biosafety Level 2 agents and practices, please refer to NIH’s “Biosafety Considerations for Research with Lentiviral Vectors”.

 

 

Poor Transduction Efficiency:

Poor transduction efficiency could be due to a low viral titer. While lentivectors can accommodate relatively large inserts (up to 8 kb) comparing to other systems, there is still a packaging limit. In general, lentivectors could transfer up to 8-kb gene inserts. However, any gene insert larger than 4kb will dramatically decreases packaging efficiency, which would results in a lower viral titer. To overcome low titers, concentrate viral particles or lower target cell density for transduction. If the transduction efficiency is low despite a high titer of virus, the total volume of transduction media on the target cells may be too high. Transduction can be carried out in a volume of media that just covers the cells; this may increase the exposure of the cells to the virus. Low speed spin (e.g., 1500 rpm for 15-30 min) may help increase the likelihood of virus-cell interactions.  Pseudotyping of the transducing virus to target more abundant receptors on a particular cell type is another potential approach.

 

Transduction Kills Target Cells:

It is possible that MOI may be too high. Perform the transduction with a lower MOI or less viral particles. Packaging cell medium may not be compatible for target cell growth. Either dilute the virus in target cell-compatible medium or concentrate and resuspend the virus in medium compatible with the target cell growth. Change the transduction media containing the virus as early as 4 hrs after transduction.

 

 

 FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

 

 

The product is shipped at 4°C for immediate use.  Upon receipt, centrifuge the vial briefly before opening.  Store at –80°C or lower and the product is stable for 3 months.  Avoid repeated freeze-thaw cycles.

 

 

The product should be employed in a Biosafety Level 2 tissue culture facility.

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

 

 

1. Immunol. Today 14:215 (1993).

2. J Biol Chem. 270 (43): 25762 (1995)

3. Science 290:84 (2000)

4. Annu. Rev. Immunol.19:275 (2001).

5. Nature Rev. Immunol. 2:580 (2002)

 

 

 

 

Product datasheet (pdf) can be downloaded here: LTV2491-PDS.pdf

 

 

 

Additional supporting documents, including COA and MSDS are available upon request.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.