Smaller Font Default Font Larger Font

You are here:

PrintEmail

Human CD90/THY1 Gene, Full-length cDNA Clone in Lentivector, Endotoxin-free DNA

Product ID: pLTC-CD90 (SKU#: LTP2186)

For Bulk Order: Call for price

Price:
$496.00
Size

Selection Marker

Description

CD90, also known as Thy1, is a GPI-anchored cell membrane protein that contains one immunoglobulin (Ig)-like V-type (IgV) domain in the extracellular region.  Cd90 is thus a member of the Ig superfamily that mediates cellular adhesion and exerts a wide range effects in different tissues.  CD90 was originally identified on mouse thymocytes as a thymocyte and pan T cell marker in mouse but not in human. CD90 is also found on various stem cells and non-lymphoid tissues such as on fibroblasts, brain cells, and activated endothelial cells. It is expressed on hematopoietic progenitor cells, neurons, and activated vascular endothelial cells.  CD90 can form dimers and higher order multimers. CD90 binds to heparin, the proteoglycan Syndecan­4, and Integrins including αMβ2, αVβ3, and αVβ5.  Through these interactions, CD90 inhibits neurite outgrowth, promotes astrocyte adhesion, mediates the extravasation of leukocytes and melanoma cells, supports the Thrombospondin­1 induced disassembly of fibroblast focal adhesions, and inhibits the activation of myofibroblast differentiation and lung fibrosis. CD90 may be a prognostic marker for Neuroblastoma (NBL) which is the most common solid tumor in children. CD90 may also play an important role in cell-cell or cell-ligand interactions during synaptogenesis and other events in the central nervous system.

 

CD90, also known as Thy1, is a GPI-anchored cell membrane protein that contains one immunoglobulin (Ig)-like V-type (IgV) domain in the extracellular region.  Cd90 is thus a member of the Ig superfamily that mediates cellular adhesion and exerts a wide range effects in different tissues.  CD90 was originally identified on mouse thymocytes as a thymocyte and pan T cell marker in mouse but not in human. CD90 is also found on various stem cells and non-lymphoid tissues such as on fibroblasts, brain cells, and activated endothelial cells. It is expressed on hematopoietic progenitor cells, neurons, and activated vascular endothelial cells.  CD90 can form dimers and higher order multimers. CD90 binds to heparin, the proteoglycan Syndecan­4, and Integrins including αMβ2, αVβ3, and αVβ5.  Through these interactions, CD90 inhibits neurite outgrowth, promotes astrocyte adhesion, mediates the extravasation of leukocytes and melanoma cells, supports the Thrombospondin­1 induced disassembly of fibroblast focal adhesions, and inhibits the activation of myofibroblast differentiation and lung fibrosis. CD90 may be a prognostic marker for Neuroblastoma (NBL) which is the most common solid tumor in children. CD90 may also play an important role in cell-cell or cell-ligand interactions during synaptogenesis and other events in the central nervous system.

 

Product Details

 

Gene Symbol: CD90; THY1; CDw90

 

NCBI Gene ID: 7070

 

Uniprot Entry: P04216

 

Construct Details: Full length human CD90/THY1 gene is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter and a selection marker, which can be used for both transient and stable expression in mammalian cells.  It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles.

 

Vector Type: pLTC or pLTC-IRES-Marker (lentiviral expression vector containing a heterologous CMV promoter, see the vector map above)

 

Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)

 

Gene Insert Size: 486 (bp)

 

Gene Insert Sequence:  

ATGAACCTGGCCATCAGCATCGCTCTCCTGCTAACAGTCTTGCAGGTCTCCCGAGGGCAGAAGGTGACCA

GCCTAACGGCCTGCCTAGTGGACCAGAGCCTTCGTCTGGACTGCCGCCATGAGAATACCAGCAGTTCACC

CATCCAGTACGAGTTCAGCCTGACCCGTGAGACAAAGAAGCACGTGCTCTTTGGCACTGTGGGGGTGCCT

GAGCACACATACCGCTCCCGAACCAACTTCACCAGCAAATACAACATGAAGGTCCTCTACTTATCCGCCT

TCACTAGCAAGGACGAGGGCACCTACACGTGTGCACTCCACCACTCTGGCCATTCCCCACCCATCTCCTC

CCAGAACGTCACAGTGCTCAGAGACAAACTGGTCAAGTGTGAGGGCATCAGCCTGCTGGCTCAGAACACC

TCGTGGCTGCTGCTGCTCCTGCTCTCCCTCTCCCTCCTCCAGGCCACGGATTTCATGTCCCTGTGA

 

 

Primers: Gene insert coding sequence can be confirmed by following primers:

(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;

(b) reverse (or 3'-end) primer: 5’-CCAGGTTTCCGGGCCCTCAC-3’

 

 

Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification.  High fidelity PCR systems should always be used. 

 

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Storage

 

The product is shipped at 4°C. Upon receipt, centrifuge the product briefly before opening the vial. It is recommended to store small aliquots at the temperature below –20°C for long-term storage and the product is stable for 6 months. 

 

 

Use a manual defrost freezer and avoid repeated freeze-thaw cycles.

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

 

References

 

1. Proc. Natl. Acad. Sci. 82:3819 (1985). 

2. Nature 355:745 (1992)

3. J. Exp. Med. 177:1331 (1993). 

4. J. Immunol. 173:3581 (2004).

5. Oncogene 24:4710 (2010).

 

 

 

Documentation

 

Product datasheet (pdf) can be downloaded here: LTP2186-PDS.pdf

 

 

 

Additional supporting documents, including COA and MSDS are available upon request.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Gene Synonym CD90; THY1; CDw90
Gene Family Ig Superfamily
Research Area Immunology
"A" - "Z" List
C
Pathway/Disease Cell Adhesion
Species
Human
Molecule Class GPI-anchored Protein
CD Antigen CD90

Search Products

Categories
Molecule Class
Gene Family
Pathway/Disease
Research Area
CD Antigen
"A" - "Z" List
Reset All

Special Offers & Rewards

Promotion

Earn discounts, credits or rewards with your purchases.

Purchase or Clone My Genes

My Gene Clones

Get the sequence-verified, expression-ready gene clones.

Recombinant Proteins

Recombinant Proteins

Oder your high-quality, recombinant proteins of interest.

Recombinant Antibodies

Recombinant Antibodies

Try our products & services for your antibody R&D.

Virus-Based Gene Expression

Virus Gene Delivery

Acquire high titer, ready-to-use viral particles.

Get in Touch with Us

Send your question or feedback on our products & services