IL2Rα (interleukin 2 receptor α), also known as CD25 and TAC antigen, is a single-pass type I transmembrane glycoprotein of the IL2R family. IL2Rα lacks structural features characteristic of members of the cytokine receptor superfamily. It contains 2 Sushi (CCP/SCR) domains in the extracellular region. IL2Rα is expressed on activated T cells and regulatory T cells. It is capable of binding IL2 with low affinity by itself.The heterodimer of IL2Rα and IL2Rβ together with the common γ chain IL2Rγ constitute the high-affinity IL2 receptor that transduces IL2 signals, leading to the activation of the intracellular signal pathways including MAPK, PI3K and JAK/STAT. The IL2R complex therefore regulates T cell proliferation, activation and other lymphoid functions.  A soluble form of IL2Rα (IL2sRα) appears in human serum. However, the function of IL2sRα is unclear. Increased levels of IL2sRα in biological fluids reportedly correlate with increased T and B cell activation and immune system activation. Increased serum levels of IL­2 sRα have been observed in patients with a variety of inflammatory conditions and in the course of some leukemias and lymphomas. Mutations in this gene are associated with immunodeficiency due to IL2Rα/CD25 deficiency.  The IL2Rα gene variations are also associated with diseases susceptibility of insulin-dependent diabetes mellitus.

IL2Rα (interleukin 2 receptor α), also known as CD25 and TAC antigen, is a single-pass type I transmembrane glycoprotein of the IL2R family. IL2Rα lacks structural features characteristic of members of the cytokine receptor superfamily. It contains 2 Sushi (CCP/SCR) domains in the extracellular region. IL2Rα is expressed on activated T cells and regulatory T cells. It is capable of binding IL2 with low affinity by itself.The heterodimer of IL2Rα and IL2Rβ together with the common γ chain IL2Rγ constitute the high-affinity IL2 receptor that transduces IL2 signals, leading to the activation of the intracellular signal pathways including MAPK, PI3K and JAK/STAT. The IL2R complex therefore regulates T cell proliferation, activation and other lymphoid functions.  A soluble form of IL2Rα (IL2sRα) appears in human serum. However, the function of IL2sRα is unclear. Increased levels of IL2sRα in biological fluids reportedly correlate with increased T and B cell activation and immune system activation. Increased serum levels of IL­2 sRα have been observed in patients with a variety of inflammatory conditions and in the course of some leukemias and lymphomas. Mutations in this gene are associated with immunodeficiency due to IL2Rα/CD25 deficiency.  The IL2Rα gene variations are also associated with diseases susceptibility of insulin-dependent diabetes mellitus.

 

Product Details

 

Gene Symbol: CD25; IL2Rα; IL2RA; Tac; p55; IL2R; TCGFR; IDDM10

 

NCBI Gene ID: 3559

 

Uniprot Entry: P01589

 

Construct Details: Full length human CD25/IL2Rα gene is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter and a selection marker, which can be used for both transient and stable expression in mammalian cells.  It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles.

 

Vector Type: pLTC or pLTC-IRES-Marker (lentiviral expression vector containing a heterologous CMV promoter, see the vector map above)

 

Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)

 

Gene Insert Size: 819 (bp)

 

Gene Insert Sequence:  

ATGGATTCATACCTGCTGATGTGGGGACTGCTCACGTTCATCATGGTGCCTGGCTGCCAGGCAGAGCTCTGTGACGATGA

CCCGCCAGAGATCCCACACGCCACATTCAAAGCCATGGCCTACAAGGAAGGAACCATGTTGAACTGTGAATGCAAGAGAG

GTTTCCGCAGAATAAAAAGCGGGTCACTCTATATGCTCTGTACAGGAAACTCTAGCCACTCGTCCTGGGACAACCAATGT

CAATGCACAAGCTCTGCCACTCGGAACACAACGAAACAAGTGACACCTCAACCTGAAGAACAGAAAGAAAGGAAAACCAC

AGAAATGCAAAGTCCAATGCAGCCAGTGGACCAAGCGAGCCTTCCAGGTCACTGCAGGGAACCTCCACCATGGGAAAATG

AAGCCACAGAGAGAATTTATCATTTCGTGGTGGGGCAGATGGTTTATTATCAGTGCGTCCAGGGATACAGGGCTCTACAC

AGAGGTCCTGCTGAGAGCGTCTGCAAAATGACCCACGGGAAGACAAGGTGGACCCAGCCCCAGCTCATATGCACAGGTGA

AATGGAGACCAGTCAGTTTCCAGGTGAAGAGAAGCCTCAGGCAAGCCCCGAAGGCCGTCCTGAGAGTGAGACTTCCTGCC

TCGTCACAACAACAGATTTTCAAATACAGACAGAAATGGCTGCAACCATGGAGACGTCCATATTTACAACAGAGTACCAG

GTAGCAGTGGCCGGCTGTGTTTTCCTGCTGATCAGCGTCCTCCTCCTGAGTGGGCTCACCTGGCAGCGGAGACAGAGGAA

GAGTAGAAGAACAATCTAG

 

 

Primers: Gene insert coding sequence can be confirmed by following primers:

(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;

(b) reverse (or 3'-end) primer: 5’-CCAGGTTTCCGGGCCCTCAC-3’

 

 

Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification.  High fidelity PCR systems should always be used. 

 

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Storage

 

The product is shipped at 4°C. Upon receipt, centrifuge the product briefly before opening the vial. It is recommended to store small aliquots at the temperature below –20°C for long-term storage and the product is stable for 6 months. 

 

 

Use a manual defrost freezer and avoid repeated freeze-thaw cycles.

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

 

References

 

1. Nature 311:626, 631 (1983)

2. Science 230:633 (1984)

3. Mol. Cell. Biol. 19: 2681 (1999)

4. Nat. Genet. 39:1074 (2006)

5. J. Immunol. 181: 1673 (2008)

 

 

 

Documentation

 

Product datasheet (pdf) can be downloaded here: LTP1624-PDS.pdf

 

 

 

Additional supporting documents, including COA and MSDS are available upon request.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.