Smaller Font Default Font Larger Font

You are here:

PrintEmail

Human CD59/MIC11/MIN1/MIRL/HRF20/MACIF Gene, Full-length cDNA in Lentivector, Endotoxin-free DNA

Product ID: pLTC-CD59 (SKU#: LTP0159)

For Bulk Order: Call for price

Price:
$596.00
Size

Selection Marker

Description

CD59 is a glycosyl-phosphatidylinositol (GPI)-linked cell surface glycoprotein. A variety of GPI-linked surface glycoproteins are composed of one or more copies of a conserved domain of ~100 amino-acid residues termed u-PAR/Ly-6 motif that was originally found in u-PAR (Urokinase plasminogen activator surface receptor) and Ly-6/CD59. The u-PAR/Ly-6 (UL) motif has 10 conserved cysteines with a defined disulfide-bonding pattern.  CD59  contains 1 copy of  u-PAR/Ly6 motifs in the extracellular domain (ECD).  CD59 antigen (also called 1F-5Ag, H19, HRF20, MACIF, MIRL, P-18 or protectin) inhibits formation of membrane attack complex (MAC), thus protecting cells from complement-mediated lysis. CD59 has a signaling role, as a GPI anchored molecule, in T cell activation and appears to have some role in cell adhesion through CD2 (controversial). CD59 associates with C9, inhibiting incorporation into C5b-8 preventing terminal steps in polymerization of the (MAC) in plasma membranes. Genetic defects in GPI-anchor attachment that cause a reduction or loss of both CD59 and CD55 on erythrocytes produce the symptoms of the disease paroxysmal nocturnal hemoglobinuria (PNH). Mutations in this gene cause CD59 deficiency, a disease resulting in hemolytic anemia and thrombosis, termed hemolytic anemia, CD59-mediated, with or without polyneuropathy (HACD59).

 

CD59 is a glycosyl-phosphatidylinositol (GPI)-linked cell surface glycoprotein. A variety of GPI-linked surface glycoproteins are composed of one or more copies of a conserved domain of ~100 amino-acid residues termed u-PAR/Ly-6 motif that was originally found in u-PAR (Urokinase plasminogen activator surface receptor) and Ly-6/CD59. The u-PAR/Ly-6 (UL) motif has 10 conserved cysteines with a defined disulfide-bonding pattern.  CD59  contains 1 copy of  u-PAR/Ly6 motifs in the extracellular domain (ECD).  CD59 antigen (also called 1F-5Ag, H19, HRF20, MACIF, MIRL, P-18 or protectin) inhibits formation of membrane attack complex (MAC), thus protecting cells from complement-mediated lysis. CD59 has a signaling role, as a GPI anchored molecule, in T cell activation and appears to have some role in cell adhesion through CD2 (controversial). CD59 associates with C9, inhibiting incorporation into C5b-8 preventing terminal steps in polymerization of the (MAC) in plasma membranes. Genetic defects in GPI-anchor attachment that cause a reduction or loss of both CD59 and CD55 on erythrocytes produce the symptoms of the disease paroxysmal nocturnal hemoglobinuria (PNH). Mutations in this gene cause CD59 deficiency, a disease resulting in hemolytic anemia and thrombosis, termed hemolytic anemia, CD59-mediated, with or without polyneuropathy (HACD59).

 

Product Details

 

Gene Symbol: CD59; 1F5; EJ16; EJ30; EL32; G344; MIN1; MIN2; MIN3; MIRL; HRF20; MACIF; MEM43; MIC11; MSK21; 16.3A5; HRF-20; MAC-IP; p18-20

 

NCBI Gene ID: 966

 

Uniprot Entry: P13987

 

Construct Details: Full length human CD59 gene is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter and with or without a selection marker, which can be used for both transient and stable expression in mammalian cells.  It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles. Multiple choices of a stable antibiotic selection marker are available.

 

Vector Type: pLTC or pLTC-IRES-Marker (lentiviral expression vector containing a heterologous CMV promoter +/- a selection marker, see the vector map above)

 

Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)

 

Gene Insert Size: 387 (bp)

 

Gene Insert Sequence:  

ATGGGAATCCAAGGAGGGTCTGTCCTGTTCGGGCTGCTGCTCGTCCTGGCTGTCTTCTGCCATTCAGGTC

ATAGCCTGCAGTGCTACAACTGTCCTAACCCAACTGCTGACTGCAAAACAGCCGTCAATTGTTCATCTGA

TTTTGATGCGTGTCTCATTACCAAAGCTGGGTTACAAGTGTATAACAAGTGTTGGAAGTTTGAGCATTGC

AATTTCAACGACGTCACAACCCGCTTGAGGGAAAATGAGCTAACGTACTACTGCTGCAAGAAGGACCTGT

GTAACTTTAACGAACAGCTTGAAAATGGTGGGACATCCTTATCAGAGAAAACAGTTCTTCTGCTGGTGAC

TCCATTTCTGGCAGCAGCCTGGAGCCTTCATCCCTAA

 

 

Primers: Gene insert coding sequence can be confirmed by following primers:

(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;

(b) reverse (or 3'-end) primer: 5’-CCAGGTTTCCGGGCCCTCAC-3’

 

 

Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification.  High fidelity PCR systems should always be used. 

 

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Storage

 

The product is shipped at 4°C. Upon receipt, centrifuge the product briefly before opening the vial. It is recommended to store small aliquots at the temperature below –20°C for long-term storage and the product is stable for 6 months. 

 

 

Use a manual defrost freezer and avoid repeated freeze-thaw cycles.

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

 

References

 

 

 

 

 

Additional supporting documents, including PDS, COA and MSDS are available upon request.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Gene Synonym CD59; 1F5; EJ16; EJ30; EL32; G344; MIN1; MIN2; MIN3; MIRL; HRF20; MACIF; MEM43; MIC11; MSK21; 16.3A5; HRF-20; MAC-IP; p18-20
Gene Family UPAR/Ly6 Family
Research Area Hematology
"A" - "Z" List
C
Pathway/Disease Complement Activation
Species
Human
Molecule Class GPI-Anchored Protein
CD Antigen CD59

Search Products

Categories
Molecule Class
Gene Family
Pathway/Disease
Research Area
CD Antigen
"A" - "Z" List
Reset All

Special Offers & Rewards

Promotion

Earn discounts, credits or rewards with your purchases.

Purchase or Clone My Genes

My Gene Clones

Get the sequence-verified, expression-ready gene clones.

Recombinant Proteins

Recombinant Proteins

Oder your high-quality, recombinant proteins of interest.

Recombinant Antibodies

Recombinant Antibodies

Try our products & services for your antibody R&D.

Virus-Based Gene Expression

Virus Gene Delivery

Acquire high titer, ready-to-use viral particles.

Get in Touch with Us

Send your question or feedback on our products & services