NCR3 (natural cytotoxicity triggering receptor 3), also known as NKp30 and CD337, is a single pass type I transmembrane glycoprotein that belongs to the NCR family of the Ig (immunoglobulin) superfamily. Like other family members, NCR3 contains a single Ig-like V-type domain in the extracellular region. Cytotoxicity of natural killer (NK) cells is regulated by a balance of signals from two types of NK receptors, activating receptors and inhibitory receptors. NCR3 is a major NK activating receptor. NCR3 is selectively expressed in all resting and activated NK cells.  It plays a key role in NK-mediated killing of tumor cells. NCR3 is also involved in NK-mediated induction of dendritic cell (DC) maturation. NCR3 forms a complex with an ITAM-bearing accessory protein CD3ζ, which undergoes phosphorylation upon a specific antibody ligation. Studies with neutralizing antibodies reveal that NCR3 is partially responsible for triggering lytic activity against several tumor cell types and that it is the main receptor responsible for NK­mediated lysis of immature dendritic cells. The B7 family member B7-H6 has been identified as a tumor cell ligand for the activating natural killer cell receptor NCR3 in humans.

NCR3 (natural cytotoxicity triggering receptor 3), also known as NKp30 and CD337, is a single pass type I transmembrane glycoprotein that belongs to the NCR family of the Ig (immunoglobulin) superfamily. Like other family members, NCR3 contains a single Ig-like V-type domain in the extracellular region. Cytotoxicity of natural killer (NK) cells is regulated by a balance of signals from two types of NK receptors, activating receptors and inhibitory receptors. NCR3 is a major NK activating receptor. NCR3 is selectively expressed in all resting and activated NK cells.  It plays a key role in NK-mediated killing of tumor cells. NCR3 is also involved in NK-mediated induction of dendritic cell (DC) maturation. NCR3 forms a complex with an ITAM-bearing accessory protein CD3ζ, which undergoes phosphorylation upon a specific antibody ligation. Studies with neutralizing antibodies reveal that NCR3 is partially responsible for triggering lytic activity against several tumor cell types and that it is the main receptor responsible for NK­mediated lysis of immature dendritic cells. The B7 family member B7-H6 has been identified as a tumor cell ligand for the activating natural killer cell receptor NCR3 in humans.

 

Product Details

 

Gene Symbol: NCR3; CD337; NKp30; NK-p30; 1C7; MALS; LY117; NCTR3; NCR-3

 

NCBI Gene ID: 259197

 

Uniprot Entry: O14931

 

Construct Details: Full length human NCR3/CD337 gene is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter, which can be used for both transient and stable expression in mammalian cells.  It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles. 

 

Vector Type: pLTC (lentiviral expression vector containing a heterologous CMV promoter, see the vector map above)

 

Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)

 

Gene Insert Size: 606 (bp)

 

Gene Insert Sequence:  

ATGGCCTGGATGCTGTTGCTCATCTTGATCATGGTCCATCCAGGATCCTGTGCTCTCTGGGTGTCCCAGCCCCCTGAGAT

TCGTACCCTGGAAGGATCCTCTGCCTTCCTGCCCTGCTCCTTCAATGCCAGCCAAGGGAGACTGGCCATTGGCTCCGTCA

CGTGGTTCCGAGATGAGGTGGTTCCAGGGAAGGAGGTGAGGAATGGAACCCCAGAGTTCAGGGGCCGCCTGGCCCCACTT

GCTTCTTCCCGTTTCCTCCATGACCACCAGGCTGAGCTGCACATCCGGGACGTGCGAGGCCATGACGCCAGCATCTACGT

GTGCAGAGTGGAGGTGCTGGGCCTTGGTGTCGGGACAGGGAATGGGACTCGGCTGGTGGTGGAGAAAGAACATCCTCAGC

TAGGGGCTGGTACAGTCCTCCTCCTTCGGGCTGGATTCTATGCTGTCAGCTTTCTCTCTGTGGCCGTGGGCAGCACCGTC

TATTACCAGGGCAAATGTCTGACCTGGAAAGGTCCAAGAAGGCAGCTGCCGGCTGTGGTCCCAGCGCCCCTCCCACCACC

ATGTGGGAGCTCAGCACATCTGCTTCCCCCAGTCCCAGGAGGCTGA

 

Primers: Gene insert coding sequence can be confirmed by following primers:

(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;

(b) reverse (or 3'-end) primer: 5’-CGGGAAGCAATAGCATGATA-3’

 

 

Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification.  High fidelity PCR systems should always be used. 

 

  

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Storage

 

The product is shipped at 4°C. Upon receipt, centrifuge the product briefly before opening the vial. It is recommended to store small aliquots at the temperature below –20°C for long-term storage and the product is stable for 6 months. 

 

 

Use a manual defrost freezer and avoid repeated freeze-thaw cycles.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

 

References

 

1. J. Exp. Med. 190:1505 (1999).

2. J. Exp. Med. 195:343 (2002). 

3. J. Immunol. 174:2653 (2005).

4. J. Immunol. 179:7385 (2007).

5. J. Exp. Med. 2061495 (2009)

 

 

Documentation

 

Product datasheet (pdf) can be downloaded here: LTP1035-PDS.pdf

 

 

 

Additional supporting documents, including COA and MSDS are available upon request.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.