OX40L (OX40 ligand), also known as TNFSF4, gp34 and CD252, is a cytokine that belongs to the tumor necrosis factor (TNF) superfamily. OX40L is a single-pass type II transmebrane glycoprotein consisting of a 23 amino acid (aa) cytoplasmic domain, a 27-aa transmembrane domain (TM) and a 133 aa extracellular domain (ECD). OX40L is expressed on the surface of activated B cells, T cells, dendritic cells and endothelial cells. Similarly to other TNF superfamily members, membrane-bound OX40L exists as a homotrimer. OX40L binds to OX40/CD134, a member of the TNF receptor superfamily that is expressed predominantly on activated CD4+ T cells. OX40 Ligand is one of the co¬stimulatory molecules in the regulation of T-cell-mediated immunity that includes B7, CD40L, CD30L, CD27L/CD70 and 4-1BBL. OX40L functions in T cell antigen-presenting cell (APC) interactions and mediates adhesion of activated T cells to endothelial cells. Polymorphisms in the OX40L gene have been associated with Sjogren's syndrome and systemic lupus erythematosus.  The interaction of OX40L:OX40 is also involved in the pathogenesis of carotid artery disease and cancer.  Engagement of OX40 on activated T cells in situ in tumors has been shown to augment immune responses and subsequent tumor regression.

OX40L (OX40 ligand), also known as TNFSF4, gp34 and CD252, is a cytokine that belongs to the tumor necrosis factor (TNF) superfamily. OX40L is a single-pass type II transmebrane glycoprotein consisting of a 23 amino acid (aa) cytoplasmic domain, a 27-aa transmembrane domain (TM) and a 133 aa extracellular domain (ECD). OX40L is expressed on the surface of activated B cells, T cells, dendritic cells and endothelial cells. Similarly to other TNF superfamily members, membrane-bound OX40L exists as a homotrimer. OX40L binds to OX40/CD134, a member of the TNF receptor superfamily that is expressed predominantly on activated CD4+ T cells. OX40 Ligand is one of the co¬stimulatory molecules in the regulation of T-cell-mediated immunity that includes B7, CD40L, CD30L, CD27L/CD70 and 4-1BBL. OX40L functions in T cell antigen-presenting cell (APC) interactions and mediates adhesion of activated T cells to endothelial cells. Polymorphisms in the OX40L gene have been associated with Sjogren's syndrome and systemic lupus erythematosus.  The interaction of OX40L:OX40 is also involved in the pathogenesis of carotid artery disease and cancer.  Engagement of OX40 on activated T cells in situ in tumors has been shown to augment immune responses and subsequent tumor regression.

  

Product Details

 

Gene Symbol: LIGHT; TNFSF14; LTg; CD258; HVEML

  

NCBI Gene ID: 7292

 

Uniprot Entry: P23510

 

Construct Details: Full length human OX40L gene is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter with or without a selection marker, which can be used for both transient and stable expression in mammalian cells.  It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles.

 

Vector Type: pLTC (lentiviral expression vector containing a heterologous CMV promoter and a marker, see the vector map above)

 

Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)

 

Gene Insert Sequence:  

ATGGAAAGGGTCCAACCCCTGGAAGAGAATGTGGGAAATGCAGCCAGGCCAAGATTCGAGAGGAACAAGC

TATTGCTGGTGGCCTCTGTAATTCAGGGACTGGGGCTGCTCCTGTGCTTCACCTACATCTGCCTGCACTT

CTCTGCTCTTCAGGTATCACATCGGTATCCTCGAATTCAAAGTATCAAAGTACAATTTACCGAATATAAG

AAGGAGAAAGGTTTCATCCTCACTTCCCAAAAGGAGGATGAAATCATGAAGGTGCAGAACAACTCAGTCA

TCATCAACTGTGATGGGTTTTATCTCATCTCCCTGAAGGGCTACTTCTCCCAGGAAGTCAACATTAGCCT

TCATTACCAGAAGGATGAGGAGCCCCTCTTCCAACTGAAGAAGGTCAGGTCTGTCAACTCCTTGATGGTG

GCCTCTCTGACTTACAAAGACAAAGTCTACTTGAATGTGACCACTGACAATACCTCCCTGGATGACTTCC

ATGTGAATGGCGGAGAACTGATTCTTATCCATCAAAATCCTGGTGAATTCTGTGTCCTTTGA

 

Primers: Gene insert coding sequence can be confirmed by following primers:

(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;

(b) reverse (or 3'-end) primer: 5’-CGGGAAGCAATAGCATGATA-3’

 

 

Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification.  High fidelity PCR systems should always be used. 

 

  

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Storage

 

The product is shipped at 4°C. Upon receipt, centrifuge the product briefly before opening the vial. It is recommended to store small aliquots at the temperature below –20°C for long-term storage and the product is stable for 6 months. 

 

 

 

 

Use a manual defrost freezer and avoid repeated freeze-thaw cycles.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

 

References

 

 

1. Mol. Cell. Biol. 11:1313-1325(1991)

2. J. Exp. Med. 180:757-762(1994)

3. EMBO J. 13:3992-4001(1994)

4. Nat. Genet. 40:83-89(2008)

5. Structure 14:1321-1330(2006)

 

 

 

 

Additional supporting documents, including PDS, COA and MSDS are available upon request.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.