Smaller Font Default Font Larger Font

You are here:

PrintEmail

Human IL6/Interleukin-6 Gene, Full-length cDNA Clone in Lentivector, Endotoxin-free DNA

Product ID: pLTC-IL6 (SKU#: LTP2887)

For Bulk Order: Call for price

Price:
$696.00
Size

Selection Marker

Description

Interleukin-6 (IL-6) is a cytokine of the IL-6 superfamily with a wide variety of biological functions in inflammation and the maturation of B cells. IL-6 has been shown to be an endogenous pyrogen capable of inducing fever in people with autoimmune diseases or infections. Human IL-6 shares 39% amino acid sequence identity with mouse and rat IL-6. IL-6 is primarily produced at sites of acute and chronic inflammation, where it is secreted into the serum and induces an inflammatory response.  IL-6 induces signaling through a surface heterodimeric receptor complex composed of a ligand binding subunit IL-6 receptor alpha (IL-6Ra) and a signal transducing subunit (gp130). IL-6 plays an essential role in the final differentiation of B-cells into Ig-secreting cells. IL-6 also acts on T-cells, hepatocytes, hematopoietic progenitor cells and cells of the CNS. It is required for the generation of TH17 cells. IL-6 also acts as a myokine. It is discharged into the bloodstream after muscle contraction and acts to increase the breakdown of fats and to improve insulin resistance. IL-6, along with TNF-alpha and IL-1, drives the acute inflammatory response. IL-6 is implicated in many inflammation-associated disease states, including suspectibility to diabetes mellitus and systemic juvenile rheumatoid arthritis. IL-6 induces myeloma and plasmacytoma growth and induces nerve cells differentiation.

 

Interleukin-6 (IL-6) is a cytokine of the IL-6 superfamily with a wide variety of biological functions in inflammation and the maturation of B cells. IL-6 has been shown to be an endogenous pyrogen capable of inducing fever in people with autoimmune diseases or infections. Human IL-6 shares 39% amino acid sequence identity with mouse and rat IL-6. IL-6 is primarily produced at sites of acute and chronic inflammation, where it is secreted into the serum and induces an inflammatory response.  IL-6 induces signaling through a surface heterodimeric receptor complex composed of a ligand binding subunit IL-6 receptor alpha (IL-6Ra) and a signal transducing subunit (gp130). IL-6 plays an essential role in the final differentiation of B-cells into Ig-secreting cells. IL-6 also acts on T-cells, hepatocytes, hematopoietic progenitor cells and cells of the CNS. It is required for the generation of TH17 cells. IL-6 also acts as a myokine. It is discharged into the bloodstream after muscle contraction and acts to increase the breakdown of fats and to improve insulin resistance. IL-6, along with TNF-alpha and IL-1, drives the acute inflammatory response. IL-6 is implicated in many inflammation-associated disease states, including suspectibility to diabetes mellitus and systemic juvenile rheumatoid arthritis. IL-6 induces myeloma and plasmacytoma growth and induces nerve cells differentiation.

 

Product Details

 

Gene Symbol: IL6; CDF; HGF; HSF; BSF2; IL-6; BSF-2; IFNB2; IFN-beta-2

 

NCBI Gene ID: 3569

 

Uniprot Entry: P05231

 

Construct Details: Full length human IL6 gene is subcloned into the Lentiviral expression vector pLTC with an upstream CMV promoter and with or without a selection marker, which can be used for both transient and stable expression in mammalian cells.  It can be co-transfected with the LentiPAK DNA mix (SKU# LP-001) into HEK293 cells to produce high titer lentiviral particles. Multiple choices of a stable antibiotic selection marker are available.

 

Vector Type: pLTC or pLTC-IRES-Marker (lentiviral expression vector containing a heterologous CMV promoter +/- a selection marker, see the vector map above)

 

Formulation: Supplied with 10 μg of endotoxin-free plasmid DNA at 200 ng/μl in sterile TE buffer (pH8.0)

 

Gene Insert Size: 639 (bp)

 

Gene Insert Sequence:  

ATGAACTCCTTCTCCACAAGCGCCTTCGGTCCAGTTGCCTTCTCCCTGGGGCTGCTCCTGGTGTTGCCTG

CTGCCTTCCCTGCCCCAGTACCCCCAGGAGAAGATTCCAAAGATGTAGCCGCCCCACACAGACAGCCACT

CACCTCTTCAGAACGAATTGACAAACAAATTCGGTACATCCTCGACGGCATCTCAGCCCTGAGAAAGGAG

ACATGTAACAAGAGTAACATGTGTGAAAGCAGCAAAGAGGCACTGGCAGAAAACAACCTGAACCTTCCAA

AGATGGCTGAAAAAGATGGATGCTTCCAATCTGGATTCAATGAGGAGACTTGCCTGGTGAAAATCATCAC

TGGTCTTTTGGAGTTTGAGGTATACCTAGAGTACCTCCAGAACAGATTTGAGAGTAGTGAGGAACAAGCC

AGAGCTGTGCAGATGAGTACAAAAGTCCTGATCCAGTTCCTGCAGAAAAAGGCAAAGAATCTAGATGCAA

TAACCACCCCTGACCCAACCACAAATGCCAGCCTGCTGACGAAGCTGCAGGCACAGAACCAGTGGCTGCA

GGACATGACAACTCATCTCATTCTGCGCAGCTTTAAGGAGTTCCTGCAGTCCAGCCTGAGGGCTCTTCGG

CAAATGTAG

 

 

Primers: Gene insert coding sequence can be confirmed by following primers:

(a) forward (or 5'-end) primer: 5’-CAAATGGGCGGTAGGCGTG-3’;

(b) reverse (or 3'-end) primer: 5’-CCAGGTTTCCGGGCCCTCAC-3’

 

 

Note: The sequence may vary due to the naturally occurring variants or mutations, such as single nucleotide polymorphism, or the artifact during PCR amplification.  High fidelity PCR systems should always be used. 

 

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Storage

 

The product is shipped at 4°C. Upon receipt, centrifuge the product briefly before opening the vial. It is recommended to store small aliquots at the temperature below –20°C for long-term storage and the product is stable for 6 months. 

 

 

Use a manual defrost freezer and avoid repeated freeze-thaw cycles.

 

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

 

References

 

1. Nature 324:73-76(1986)

2. J. Immunol. 139:4116-4121(1987)

3. Cytokine 3:204-211(1991)

4. EMBO J. 16:989-997(1997)

5. J. Clin. Invest. 102:1369-1376(1998)

 

  

 

Product datasheet (pdf) and additional supporting documents, including COA and MSDS are available upon request.

 

 

 

FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC OR THERAPEUTIC USE IN HUMAN.

Restriction: This product is not transferable or re-sellable.  Customer obtain no right to transfer, assign, or sublicense its use rights, or to transfer, resell, package, or otherwise distribute the product, or to use the product for the benefit of any third party or for any commercial purpose.  Customer may only use the product in compliance with applicable local, state and federal laws, regulations and rules.  Customer may not directly or indirectly use the product or allow the transfer, transmission, export or re-export of all or any part of the product in violation of any export control law or regulation of the united states or any other relevant jurisdiction.  Your use of this product constitutes acceptance of the terms of this limited use agreement.  Please refer to our “terms & conditions” for details.  If you are not willing to accept the limitation of this agreement, G&P Biosciences will accept return of the product for a full/partial refund.

 

Gene Synonym IL6; CDF; HGF; HSF; BSF2; IL-6; BSF-2; IFNB2; IFN-beta-2
Gene Family IL-6/LIF/OSM Family
Research Area Immunology
"A" - "Z" List
I
Pathway/Disease B Cell Maturation
Species
Human
Molecule Class Cytokine (secreted)

Search Products

Categories
Molecule Class
Gene Family
Pathway/Disease
Research Area
CD Antigen
"A" - "Z" List
Reset All

Special Offers & Rewards

Promotion

Earn discounts, credits or rewards with your purchases.

Purchase or Clone My Genes

My Gene Clones

Get the sequence-verified, expression-ready gene clones.

Recombinant Proteins

Recombinant Proteins

Oder your high-quality, recombinant proteins of interest.

Recombinant Antibodies

Recombinant Antibodies

Try our products & services for your antibody R&D.

Virus-Based Gene Expression

Virus Gene Delivery

Acquire high titer, ready-to-use viral particles.

Get in Touch with Us

Send your question or feedback on our products & services